GEO Profile Links for Gene (Select 665054) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 20

Select item 468110591.

Kcng2 - Dicer inactivation effect on the embryonic heart

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL5025, 13559 (ID_REF), GDS3033, BE650864

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46811059

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 156153302.

Kcng2 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL2727, 31318 (ID_REF), GDS1527, AV020944, 1190020P15 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15615330

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 327385243.

Kcng2 - Prostate cancer progression model: stromal cell

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL4371, 15124 (ID_REF), GDS2443, BY274687

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32738524

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 187822104.

Kcng2 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL2897, 151010 (ID_REF), GDS1729, BB079375

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18782210

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643834185.

D330025C20Rik - Hypertension model: heart

Annotation:: D330025C20Rik, RIKEN cDNA D330025C20 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108820_TGI_at (ID_REF), GDS3673, AK142265

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64383418

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 327335456.

Kcng2 - Prostate cancer progression model: stromal cell

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL4371, 10145 (ID_REF), GDS2443, BY274687

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32733545

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 414098107.

Kcng2 - Nephronophthisis model

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL2897, 151010 (ID_REF), GDS2817, BB079375

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41409810

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74934578.

Kcng2 - MPSS transcriptome analysis project

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCGGCTAGCATATGGG (ID_REF), GDS868, AA035847

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7493457

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 414101019.

Kcng2 - Nephronophthisis model

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL2897, 153077 (ID_REF), GDS2817, BE650864

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41410101

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6446261810.

D330025C20Rik - Hypertension model: kidney

Annotation:: D330025C20Rik, RIKEN cDNA D330025C20 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108820_TGI_at (ID_REF), GDS3675, AK142265

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64462618

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1878250111.

Kcng2 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL2897, 153077 (ID_REF), GDS1729, BE650864

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18782501

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6442301812.

D330025C20Rik - Hypertension model: liver

Annotation:: D330025C20Rik, RIKEN cDNA D330025C20 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108820_TGI_at (ID_REF), GDS3674, AK142265

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64423018

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2037401913.

Kcng2 - Surgical model of acute lymphedema induction

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL3506, 31318 (ID_REF), GDS1810, AV020944, 1190020P15 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 9 samples

ID:: 20374019

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1297234114.

Kcng2 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL1345, 2741 (ID_REF), GDS1357, AA433531

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12972341

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4681083915.

Kcng2 - Dicer inactivation effect on the embryonic heart

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL5025, 13339 (ID_REF), GDS3033, BB079375

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46810839

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9785601816.

D330025C20Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: D330025C20Rik, RIKEN cDNA D330025C20 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108820_TGI_at (ID_REF), GDS4527, AK142265

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97856018

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9714301817.

D330025C20Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: D330025C20Rik, RIKEN cDNA D330025C20 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108820_TGI_at (ID_REF), GDS4495, AK142265

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97143018

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7563257018.

Kcng2 - High and Low Anxiety: multiple brain regions

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL7467, 18834 (ID_REF), GDS4001, AA433531

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75632570

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6434381819.

D330025C20Rik - Hypertension model: aorta

Annotation:: D330025C20Rik, RIKEN cDNA D330025C20 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108820_TGI_at (ID_REF), GDS3672, AK142265

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64343818

GEO DataSets Gene Chromosome neighbors

Select item 763115720.

Kcng2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Kcng2, Potassium voltage-gated channel, subfamily G, member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCGGCTAGCATATGGG (ID_REF), GDS878, AA035847

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7631157

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 665054) (20)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 20

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity