GEO Profile Links for Gene (Select 74928) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 16

Select item 215849361.

4930467K11Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL1942, 34936 (ID_REF), GDS1882, AK015522

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21584936

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 499538822.

4930467K11Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226601_1 (ID_REF), GDS3148, AK015522

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49953882

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 215849353.

4930467K11Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL1942, 34935 (ID_REF), GDS1882, AK015522

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21584935

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 716862214.

4930467K11Rik - Fasting effect on multiple tissues: time course

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL11012, 20721 (ID_REF), GDS3893, AK015522

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71686221

GEO DataSets Gene Chromosome neighbors

Select item 978756335.

4930467K11Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100094108_TGI_at (ID_REF), GDS4527, AK015522

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97875633

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 625572966.

4930467K11Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl37946.4.1_126-S (ID_REF), GDS3621, 4930467K11Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62557296

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 619568967.

4930467K11Rik - Eset depletion effect on embryonic stem cell

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl37946.4.1_126-S (ID_REF), GDS3599, 4930467K11Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61956896

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74803128.

4930467K11Rik - MPSS transcriptome analysis project

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTTCTATGTAGCTCTG (ID_REF), GDS868, AK015522

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7480312

GEO DataSets Gene Chromosome neighbors

Select item 756750249.

4930467K11Rik - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL6481, 103520050 (ID_REF), GDS4002, 4930467K11Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75675024

GEO DataSets Gene Chromosome neighbors

Select item 9716263310.

4930467K11Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100094108_TGI_at (ID_REF), GDS4495, AK015522

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97162633

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6436343311.

4930467K11Rik - Hypertension model: aorta

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100094108_TGI_at (ID_REF), GDS3672, AK015522

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64363433

GEO DataSets Gene Chromosome neighbors

Select item 6444263312.

4930467K11Rik - Hypertension model: liver

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100094108_TGI_at (ID_REF), GDS3674, AK015522

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64442633

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6448223313.

4930467K11Rik - Hypertension model: kidney

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100094108_TGI_at (ID_REF), GDS3675, AK015522

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64482233

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 761801214.

4930467K11Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTTCTATGTAGCTCTG (ID_REF), GDS878, AK015522

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7618012

GEO DataSets Gene Chromosome neighbors

Select item 12784772415.

4930467K11Rik - Rhabdomyosarcoma model

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL6481, 103520050 (ID_REF), GDS5527, 4930467K11Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127847724

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6440303316.

4930467K11Rik - Hypertension model: heart

Annotation:: 4930467K11Rik, RIKEN cDNA 4930467K11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100094108_TGI_at (ID_REF), GDS3673, AK015522

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64403033

GEO DataSets Gene Profile neighbors Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 74928) (16)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity