GEO Profile Links for Gene (Select 75145) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 16

Select item 215907711.

4930547E14Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL1942, 40771 (ID_REF), GDS1882, AK016054

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21590771

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 716687582.

4930547E14Rik - Fasting effect on multiple tissues: time course

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL11012, 3258 (ID_REF), GDS3893, AK016054

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71668758

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 215907703.

4930547E14Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL1942, 40770 (ID_REF), GDS1882, AK016054

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21590770

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 499686944.

4930547E14Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1221228_1 (ID_REF), GDS3148, AK016054

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49968694

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 625577845.

4930547E14Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl49007.2.1_11-S (ID_REF), GDS3621, 4930547E14Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62557784

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74943746.

4930547E14Rik - MPSS transcriptome analysis project

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGGAATCTGTTATCG (ID_REF), GDS868, AK016054

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7494374

GEO DataSets Gene Chromosome neighbors

Select item 756897477.

4930547E14Rik - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL6481, 102570484 (ID_REF), GDS4002, 4930547E14Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75689747

GEO DataSets Gene Chromosome neighbors

Select item 619573848.

4930547E14Rik - Eset depletion effect on embryonic stem cell

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl49007.2.1_11-S (ID_REF), GDS3599, 4930547E14Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61957384

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644232939.

4930547E14Rik - Hypertension model: liver

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085241_TGI_at (ID_REF), GDS3674, AK016054

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64423293

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12786244710.

4930547E14Rik - Rhabdomyosarcoma model

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL6481, 102570484 (ID_REF), GDS5527, 4930547E14Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127862447

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 763207411.

4930547E14Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGGAATCTGTTATCG (ID_REF), GDS878, AK016054

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7632074

GEO DataSets Gene Chromosome neighbors

Select item 6434409312.

4930547E14Rik - Hypertension model: aorta

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085241_TGI_at (ID_REF), GDS3672, AK016054

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64344093

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6438369313.

4930547E14Rik - Hypertension model: heart

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085241_TGI_at (ID_REF), GDS3673, AK016054

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64383693

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6446289314.

4930547E14Rik - Hypertension model: kidney

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085241_TGI_at (ID_REF), GDS3675, AK016054

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64462893

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9785629315.

4930547E14Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085241_TGI_at (ID_REF), GDS4527, AK016054

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97856293

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9714329316.

4930547E14Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 4930547E14Rik, RIKEN cDNA 4930547E14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085241_TGI_at (ID_REF), GDS4495, AK016054

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97143293

GEO DataSets Gene Profile neighbors Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 75145) (16)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity