GEO Profiles Links for Nucleotide (Select 117414163) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 312

<< First< Prev

Page of 16

Next >Last >>

Select item 644207511.

Tm7sf2 - Hypertension model: liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100104253_TGI_at (ID_REF), GDS3674, NM_028454

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64420751

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1222876502.

Tm7sf2 - Industrial pollution effect on liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 10350 (ID_REF), GDS5331, NM_028454, A_52_P35064 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122287650

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640587943.

Tm7sf2 - SIRT1 deficiency effect on the liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P35064 (ID_REF), GDS3666, NM_028454, A_52_P35064 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64058794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130235074.

Tm7sf2 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL891, 16307 (ID_REF), GDS1360, NM_028454, A_51_P246568 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13023507

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152614505.

Tm7sf2 - Glucocorticoid effect on the male liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL4134, 10350 (ID_REF), GDS5035, NM_028454, A_52_P35064 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115261450

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1041932226.

Tm7sf2 - SIRT3 deficient liver response to a high fat diet

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6246, 10465342 (ID_REF), GDS4817, NM_028454, AF480070, AK037325, AK040016, BC014769, AK134512, AK043687, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 104193222

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 551826507.

Tm7sf2 - Iron enriched and deficient diets effect on the liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL4134, 10350 (ID_REF), GDS3373, NM_028454, A_52_P35064 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55182650

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969694228.

Tm7sf2 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6246, 10465342 (ID_REF), GDS4490, NM_028454, AF480070, AK037325, AK040016, BC014769, AK134512, AK043687, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96969422

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666482229.

Tm7sf2 - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6246, 10465342 (ID_REF), GDS3748, NM_028454, AF480070, AK037325, AK040016, BC014769, AK134512, AK043687, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66648222

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11530805010.

Tm7sf2 - Glucocorticoid effect on the female liver

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL4134, 10350 (ID_REF), GDS5036, NM_028454, A_52_P35064 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115308050

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762845311.

Tm7sf2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCATCATGGCTCTGGC (ID_REF), GDS878, NM_028454

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7628453

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10680502212.

Tm7sf2 - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6246, 10465342 (ID_REF), GDS4899, NM_028454, AF480070, AK037325, AK040016, BC014769, AK134512, AK043687, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106805022

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11374025113.

Tm7sf2 - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL11533, 10465342 (ID_REF), GDS4918, NM_028454, BC014769, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113740251

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10292652214.

Tm7sf2 - Liver response to a high fat diet: time course

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6246, 10465342 (ID_REF), GDS4783, NM_028454, AF480070, AK037325, AK040016, BC014769, AK134512, AK043687, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102926522

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11334675115.

Tm7sf2 - c-Jun N-terminal kinase-1 deletion effect on bile duct ligation model of liver fibrosis: time course

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL11533, 10465342 (ID_REF), GDS4878, NM_028454, BC014769, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 113346751

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2493840716.

Tm7sf2 - Estren effect on the uterus: time course

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL891, 16307 (ID_REF), GDS2077, NM_028454, A_51_P246568 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24938407

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8121662217.

Tm7sf2 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6246, 10465342 (ID_REF), GDS4162, NM_028454, AF480070, AK037325, AK040016, BC014769, AK134512, AK043687, chr19:6062821-6067850 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81216622

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7507379418.

Tm7sf2 - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P35064 (ID_REF), GDS3986, NM_028454, A_52_P35064 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75073794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6620460719.

Tm7sf2 - X chromosome dosage model

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1259722 (ID_REF), GDS3728, NM_028454

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66204607

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6506648120.

Tm7sf2 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Tm7sf2, transmembrane 7 superfamily member 2

Organism:: Mus musculus

Reporter:: GPL2995, 730299 (ID_REF), GDS3692, NM_028454

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65066481

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 117414163) (312)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 312

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity