GEO Profiles Links for Nucleotide (Select 12850658) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 18

Select item 1125043651.

2810455B08Rik - Wnt4 mutation effect on female embryonic gonads

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL3108, 14265 (ID_REF), GDS2574, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112504365

GEO DataSets Gene

Select item 978627712.

2810455B08Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100117778_TGI_at (ID_REF), GDS4527, AK013351

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97862771

GEO DataSets Gene Profile neighbors

Select item 971497713.

2810455B08Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100117778_TGI_at (ID_REF), GDS4495, AK013351

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97149771

GEO DataSets Gene Profile neighbors

Select item 716748844.

2810455B08Rik - Fasting effect on multiple tissues: time course

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL11012, 9384 (ID_REF), GDS3893, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71674884

GEO DataSets Gene

Select item 644693715.

2810455B08Rik - Hypertension model: kidney

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100117778_TGI_at (ID_REF), GDS3675, AK013351

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64469371

GEO DataSets Gene Profile neighbors

Select item 644297716.

2810455B08Rik - Hypertension model: liver

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100117778_TGI_at (ID_REF), GDS3674, AK013351

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64429771

GEO DataSets Gene Profile neighbors

Select item 643901717.

2810455B08Rik - Hypertension model: heart

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100117778_TGI_at (ID_REF), GDS3673, AK013351

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64390171

GEO DataSets Gene Profile neighbors

Select item 643505718.

2810455B08Rik - Hypertension model: aorta

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100117778_TGI_at (ID_REF), GDS3672, AK013351

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64350571

GEO DataSets Gene Profile neighbors

Select item 499705899.

2810455B08Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226883_1 (ID_REF), GDS3148, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49970589

GEO DataSets Gene

Select item 3030510910.

2810455B08Rik - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m14345_at (ID_REF), GDS2327, AK013351

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30305109

GEO DataSets Gene Profile neighbors

Select item 2586558711.

2810455B08Rik - Developing mammary gland: terminal end buds and ducts

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL2660, 14587 (ID_REF), GDS2115, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25865587

GEO DataSets Gene Profile neighbors

Select item 2159250012.

2810455B08Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1942, 42500 (ID_REF), GDS1882, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21592500

GEO DataSets Gene Profile neighbors

Select item 2159249913.

2810455B08Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1942, 42499 (ID_REF), GDS1882, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21592499

GEO DataSets Gene Profile neighbors

Select item 2143504414.

2810455B08Rik - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1792, M200010526 (ID_REF), GDS1874, AK013351

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21435044

GEO DataSets Gene Profile neighbors

Select item 1841572615.

2810455B08Rik - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL2623, M200010526 (ID_REF), GDS1707, AK013351

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18415726

GEO DataSets Gene Profile neighbors

Select item 762497816.

2810455B08Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTCCTTACTCTTGTG (ID_REF), GDS878, AK013351

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7624978

GEO DataSets Gene

Select item 748727817.

2810455B08Rik - MPSS transcriptome analysis project

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTCCTTACTCTTGTG (ID_REF), GDS868, AK013351

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487278

GEO DataSets Gene

Select item 463860918.

2810455B08Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: 2810455B08Rik, RIKEN cDNA 2810455B08 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m14345_at (ID_REF), GDS592, AK013351

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4638609

GEO DataSets Gene

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12850658) (18)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 18

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity