GEO Profiles Links for Nucleotide (Select 12851712) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 18

Select item 1124928601.

Zfyve9 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL3108, 2760 (ID_REF), GDS2574, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112492860

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 978452232.

Zfyve9 - Atherosclerosis susceptibility model: macrophages

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL9734, 100096043_TGI_at (ID_REF), GDS4527, AK014069

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97845223

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 971322233.

Zfyve9 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL9734, 100096043_TGI_at (ID_REF), GDS4495, AK014069

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97132223

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 716684984.

Zfyve9 - Fasting effect on multiple tissues: time course

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL11012, 2998 (ID_REF), GDS3893, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71668498

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644518235.

Zfyve9 - Hypertension model: kidney

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL9734, 100096043_TGI_at (ID_REF), GDS3675, AK014069

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64451823

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644122236.

Zfyve9 - Hypertension model: liver

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL9734, 100096043_TGI_at (ID_REF), GDS3674, AK014069

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64412223

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643726237.

Zfyve9 - Hypertension model: heart

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL9734, 100096043_TGI_at (ID_REF), GDS3673, AK014069

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64372623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643330238.

Zfyve9 - Hypertension model: aorta

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL9734, 100096043_TGI_at (ID_REF), GDS3672, AK014069

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64333023

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 499687639.

Zfyve9 - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1536, 1218444_1 (ID_REF), GDS3148, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49968763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3030421710.

Zfyve9 - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m13453_at (ID_REF), GDS2327, AK014069

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30304217

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 2586743811.

Zfyve9 - Developing mammary gland: terminal end buds and ducts

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL2660, 16438 (ID_REF), GDS2115, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25867438

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2157491712.

Zfyve9 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1942, 24917 (ID_REF), GDS1882, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21574917

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2157491613.

Zfyve9 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1942, 24916 (ID_REF), GDS1882, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21574916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2143296114.

Zfyve9 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1792, M200008443 (ID_REF), GDS1874, AK014069

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21432961

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1841364315.

Zfyve9 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL2623, M200008443 (ID_REF), GDS1707, AK014069

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18413643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763522716.

Zfyve9 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTCACGTACCCGGCCG (ID_REF), GDS878, AK014069

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7635227

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 749752717.

Zfyve9 - MPSS transcriptome analysis project

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTCACGTACCCGGCCG (ID_REF), GDS868, AK014069

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7497527

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 463771718.

Zfyve9 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Zfyve9, Zinc finger, FYVE domain containing 9

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m13453_at (ID_REF), GDS592, AK014069

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4637717

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12851712) (18)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 18

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity