GEO Profiles Links for Nucleotide (Select 13879464) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 2639

<< First< Prev

Page of 132

Next >Last >>

Select item 220083861.

Slc25a29 - Hepatocyte nuclear factor 4 alpha knockout effect on the embryonic liver

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS1916, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22008386

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 388167752.

Slc25a29 - Pubertal mammary gland development

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL339, 1423980_at (ID_REF), GDS2721, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38816775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 388167743.

Slc25a29 - Pubertal mammary gland development

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL339, 1423979_a_at (ID_REF), GDS2721, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38816774

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751711864.

Slc25a29 - Diabetic pregnancy model: placenta and decidua

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS3989, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 75171186

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569455865.

Slc25a29 - Vancomycin effect on the kidney: dose response

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS3435, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56945586

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751711876.

Slc25a29 - Diabetic pregnancy model: placenta and decidua

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423981_x_at (ID_REF), GDS3989, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 75171187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 325853857.

Slc25a29 - Limbal and central corneal epithelial basal cell comparison

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS2433, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32585385

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751711858.

Slc25a29 - Diabetic pregnancy model: placenta and decidua

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS3989, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 75171185

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 354767869.

Slc25a29 - Regenerating liver and developing embryonic liver comparison

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS2577, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 35476786

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4881258510.

Slc25a29 - Alpha 2B-adrenoceptor deficient embryo and its placenta

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS3108, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 48812585

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9545088711.

Slc25a29 - NZM2410-derived lupus susceptibility locus Sle2c1: peritoneal cavity B cells

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423981_x_at (ID_REF), GDS4191, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 95450887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3700888612.

Slc25a29 - Asthma model: lungs

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS2647, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37008886

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7971318513.

Slc25a29 - Pten-null, K-ras-activated prostate cancer model

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS4125, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 79713185

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7971318714.

Slc25a29 - Pten-null, K-ras-activated prostate cancer model

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423981_x_at (ID_REF), GDS4125, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 79713187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753405915.

Slc25a29 - MPSS transcriptome analysis project

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1010, GATCACGCCAGTGTAGGGTC (ID_REF), GDS868, BC006711

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7534059

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 9805848516.

Slc25a29 - HdhQ111 knock-in model of Huntington's disease: striatum and cerebellum

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS4534, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 98058485

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7324398517.

Slc25a29 - Huntington's disease CAG knock-in effect on striatum and cerebellum

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS3935, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 73243985

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4737428618.

Slc25a29 - Various normal tissues

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS3052, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 47374286

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4881258619.

Slc25a29 - Alpha 2B-adrenoceptor deficient embryo and its placenta

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423980_at (ID_REF), GDS3108, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 48812586

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10186478520.

Slc25a29 - Embryonic primary cortical neuron response to knockdown of multiple autism candidate genes

Annotation:: Slc25a29, solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29

Organism:: Mus musculus

Reporter:: GPL1261, 1423979_a_at (ID_REF), GDS4759, 214663 (Gene ID), BC006711

DataSet type:: Expression profiling by array, count, 37 samples

ID:: 101864785

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 132

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 13879464) (2639)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 2639

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity