GEO Profiles Links for Nucleotide (Select 14789653) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 147

<< First< Prev

Page of 8

Next >Last >>

Select item 1144012761.

Txn1 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4948, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114401276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143645762.

Txn1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4946, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114364576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74688573.

Txn1 - MPSS transcriptome analysis project

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGCCCTTCTTCCATT (ID_REF), GDS868, BC010756

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7468857

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1123568764.

Txn1 - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS5092, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 112356876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969745765.

Txn1 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4490, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96974576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1291012766.

Txn1 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS5628, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129101276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 794004767.

Txn1 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4116, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79400476

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1256869768.

Txn1 - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS5421, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125686976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1065996769.

Txn1 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4893, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106599676

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10643707610.

Txn1 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4886, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106437076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10006097611.

Txn1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4588, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100060976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8962397612.

Txn1 - Lung epithelium response to fungal allergen Alternaria

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4423, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89623976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11404957613.

Txn1 - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4932, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114049576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13069697614.

Txn1 - Glucagon effect on hepatocytes deficient in lysine acetyltransferase 2B or WD repeat-containing protein 5

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS5673, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 130696976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 760655715.

Txn1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGCCCTTCTTCCATT (ID_REF), GDS878, BC010756

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7606557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6665337616.

Txn1 - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS3748, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66653376

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784917617.

Txn1 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4944, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107849176

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8808897618.

Txn1 - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4334, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88088976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683717619.

Txn1 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS4486, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96837176

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7510627620.

Txn1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Txn1, thioredoxin 1

Organism:: Mus musculus

Reporter:: GPL6246, 10513195 (ID_REF), GDS3987, NM_011660, BC010756, chr4:57943373-57956291 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75106276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 14789653) (147)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 147

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity