GEO Profiles Links for Nucleotide (Select 15278020) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 15

Select item 74878351.

Diaph1 - MPSS transcriptome analysis project

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCATTCCTCAAGACTA (ID_REF), GDS868, BC012974

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487835

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 44911602.

Diaph1 - Zygotic gene activation

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 22060 (ID_REF), GDS579, AK012707, BC012974, BC021396, BC024979, BC029331, BC070412, BZ689953, CL210648, CL213285, CL214690, L0939A03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4491160

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44678603.

Diaph1 - Preimplantation development

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 22060 (ID_REF), GDS578, AK012707, BC012974, BC021396, BC024979, BC029331, BC070412, BZ689953, CL210648, CL213285, CL214690, L0939A03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4467860

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 499700634.

Diaph1 - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL1536, 1222243_1 (ID_REF), GDS3148, BC012974

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49970063

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215941845.

Diaph1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL1942, 44184 (ID_REF), GDS1882, BC012974

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21594184

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 716821136.

Diaph1 - Fasting effect on multiple tissues: time course

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL11012, 16613 (ID_REF), GDS3893, BC012974

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682113

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44845777.

Diaph1 - Zygotic gene activation

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 15477 (ID_REF), GDS579, BC012974, K0149B10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4484577

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61583608.

Diaph1 - Blastocyst dormancy and activation comparison

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 22060 (ID_REF), GDS752, AK012707, BC012974, BC021396, BC024979, BC029331, BC070412, BZ689953, CL210648, CL213285, CL214690, L0939A03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6158360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215941859.

Diaph1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL1942, 44185 (ID_REF), GDS1882, BC012974

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21594185

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446127710.

Diaph1 - Preimplantation development

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 15477 (ID_REF), GDS578, BC012974, K0149B10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4461277

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615177711.

Diaph1 - Blastocyst dormancy and activation comparison

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 15477 (ID_REF), GDS752, BC012974, K0149B10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6151777

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762553512.

Diaph1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCATTCCTCAAGACTA (ID_REF), GDS878, BC012974

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7625535

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 613981813.

Diaph1 - Blastocyst dormancy and activation comparison

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 3518 (ID_REF), GDS752, AK012707, BC012974, BC021396, BC024979, BC029331, BC070412, BZ689953, CL210648, CL213285, CL214690, C0801B07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6139818

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 444931814.

Diaph1 - Preimplantation development

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 3518 (ID_REF), GDS578, AK012707, BC012974, BC021396, BC024979, BC029331, BC070412, BZ689953, CL210648, CL213285, CL214690, C0801B07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4449318

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447261815.

Diaph1 - Zygotic gene activation

Annotation:: Diaph1, diaphanous related formin 1

Organism:: Mus musculus

Reporter:: GPL870, 3518 (ID_REF), GDS579, AK012707, BC012974, BC021396, BC024979, BC029331, BC070412, BZ689953, CL210648, CL213285, CL214690, C0801B07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4472618

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 15278020) (15)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 15

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity