GEO Profiles Links for Nucleotide (Select 158187512) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 460

<< First< Prev

Page of 23

Next >Last >>

Select item 63273821.

Plekha4 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL891, 4782 (ID_REF), GDS775, NM_148927, A_51_P501858 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6327382

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1277395042.

Plekha4 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243826 (ID_REF), GDS5520, NM_148927, PLEKHA4 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127739504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206604443.

Plekha4 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL3222, M300012659 (ID_REF), GDS1826, NM_148927, BC021387

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20660444

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 176901824.

Plekha4 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL891, 4782 (ID_REF), GDS1675, NM_148927, A_51_P501858 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17690182

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1248368515.

Plekha4 - DPP4A overexpression effect on fibroblast cell line

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1243826 (ID_REF), GDS5400, NM_148927

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124836851

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728365116.

Plekha4 - Spatial and temporal development of mammalian salivary glands

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P501858 (ID_REF), GDS3922, NM_148927, A_51_P501858 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72836511

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 735897537.

Plekha4 - Rho kinase inhibitor fasudil effect on forebrain astrocyte culture: time course

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3102085 (ID_REF), GDS3944, NM_148927

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 73589753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299438058.

Plekha4 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3028896 (ID_REF), GDS5651, NM_148927, PLEKHA4 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129943805

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206604429.

Plekha4 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL3222, M300012658 (ID_REF), GDS1826, NM_148927, BC021387

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20660442

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4691680910.

Plekha4 - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL4234, 4230372 (ID_REF), GDS3037, NM_148927

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46916809

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7317645111.

Plekha4 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1243826 (ID_REF), GDS3932, NM_148927

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73176451

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12994380412.

Plekha4 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243826 (ID_REF), GDS5651, NM_148927, PLEKHA4 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129943804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12004650413.

Plekha4 - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243826 (ID_REF), GDS5271, NM_148927, PLEKHA4 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 120046504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13270540414.

Plekha4 - Diet-induced obesity model: white adipose tissue

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243826 (ID_REF), GDS6247, NM_148927, PLEKHA4 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132705404

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12890005115.

Plekha4 - Interferon-gamma effect on lipopolysaccharide-activated bone marrow-derived macrophages

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1243826 (ID_REF), GDS5623, NM_148927

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 128900051

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13000655116.

Plekha4 - Lymphotoxin-β receptor agonist antibody effect on lipopolysaccharide-stimulated embryonic fibroblasts

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1243826 (ID_REF), GDS5655, NM_148927

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 130006551

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3016659517.

Plekha4 - High and low weight gainers: adipose tissue

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL2995, 924098 (ID_REF), GDS2319, NM_148927

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30166595

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749608218.

Plekha4 - MPSS transcriptome analysis project

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAAGTCTCCATCCCC (ID_REF), GDS868, NM_148927

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7496082

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12788235119.

Plekha4 - White adipose tissue development

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1243826 (ID_REF), GDS5528, NM_148927

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 127882351

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2066044620.

Plekha4 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Plekha4, pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Organism:: Mus musculus

Reporter:: GPL3222, M300012661 (ID_REF), GDS1826, NM_148927, BC021387

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20660446

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 23

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 158187512) (460)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 460

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity