GEO Profiles Links for Nucleotide (Select 17391249) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 290

<< First< Prev

Page of 15

Next >Last >>

Select item 880862561.

Nanp - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS4334, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88086256

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 880819382.

Nanp - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4334, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88081938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666463383.

Nanp - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS3748, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66646338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1046922384.

Nanp - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4827, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104692238

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1046965565.

Nanp - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS4827, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104696556

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968301386.

Nanp - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4486, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96830138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666506567.

Nanp - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS3748, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66650656

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75229458.

Nanp - MPSS transcriptome analysis project

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCCCAACCCTGCTGC (ID_REF), GDS868, BC018527

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7522945

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 793934389.

Nanp - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4116, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79393438

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7939775610.

Nanp - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS4116, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79397756

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683445611.

Nanp - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS4486, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96834456

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8471673812.

Nanp - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4371, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84716738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8472105613.

Nanp - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS4371, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84721056

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766064514.

Nanp - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCCCAACCCTGCTGC (ID_REF), GDS878, BC018527

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7660645

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6750063815.

Nanp - Early-passage induced pluripotent stem (iPS) cells derived from various somatic cell populations

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS3770, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 67500638

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8811863816.

Nanp - Sox9+ pancreatic cells: developmental time course

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4335, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88118638

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8749825617.

Nanp - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS4317, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87498256

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6750495618.

Nanp - Early-passage induced pluripotent stem (iPS) cells derived from various somatic cell populations

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10488550 (ID_REF), GDS3770, NM_026086, BC018527, BC083086, chr2:151029685-151039379 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 67504956

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7537673819.

Nanp - Developing testis and ovary

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS3995, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75376738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8121473820.

Nanp - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Nanp, N-acetylneuraminic acid phosphatase

Organism:: Mus musculus

Reporter:: GPL6246, 10447483 (ID_REF), GDS4162, NM_026086, BC018527, BC083086, chr17:91236771-91238140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81214738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 17391249) (290)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 290

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity