GEO Profiles Links for Nucleotide (Select 18204837) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 12

Select item 1125245481.

Auts2 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL4783, M300006805 (ID_REF), GDS2645, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112524548

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1125127932.

Auts2 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL4783, M200006717 (ID_REF), GDS2645, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112512793

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1124921193.

Auts2 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL3108, 2019 (ID_REF), GDS2574, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112492119

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 459661594.

Auts2 - Hepatoerythropoietic porphyria model

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Danio rerio

Reporter:: GPL5692, mwgzebrafish#05634 (ID_REF), GDS2991, BC021509

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 45966159

GEO DataSets Gene Profile neighbors Homologene neighbors

Select item 296622355.

Auts2 - Atherogenic diet effect on the liver: time course

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL1292, AGmmA230415 (ID_REF), GDS2292, BC021509

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29662235

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 258556786.

Auts2 - Developing mammary gland: terminal end buds and ducts

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL2660, 4678 (ID_REF), GDS2115, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25855678

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214312357.

Auts2 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL1792, M200006717 (ID_REF), GDS1874, BC021509

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21431235

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 206519878.

Auts2 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL3222, M300006805 (ID_REF), GDS1826, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20651987

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 206519869.

Auts2 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL3222, M200006717 (ID_REF), GDS1826, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20651986

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1841191710.

Auts2 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL2623, M200006717 (ID_REF), GDS1707, BC021509

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18411917

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762143611.

Auts2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCCCGGAGGACTACG (ID_REF), GDS878, BC021509

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7621436

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 748373612.

Auts2 - MPSS transcriptome analysis project

Annotation:: Auts2, autism susceptibility candidate 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCCCGGAGGACTACG (ID_REF), GDS868, BC021509

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483736

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 18204837) (12)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 12

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity