GEO Profiles Links for Nucleotide (Select 194097449) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 297

<< First< Prev

Page of 15

Next >Last >>

Select item 130015401.

Catsper4 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS1359, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13001540

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162546962.

Catsper4 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2991970 (ID_REF), GDS5172, NM_177866, CATSPER4 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116254696

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74659883.

Catsper4 - MPSS transcriptome analysis project

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTGCGCTGGTCAGCA (ID_REF), GDS868, NM_177866

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7465988

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 249397404.

Catsper4 - Estren effect on the uterus: time course

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS2077, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24939740

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316276465.

Catsper4 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P234440 (ID_REF), GDS5818, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131627646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278445966.

Catsper4 - Rhabdomyosarcoma model

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL6481, 3440181 (ID_REF), GDS5527, NM_177866, Catsper4 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127844596

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 177030407.

Catsper4 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS1675, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17703040

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249630408.

Catsper4 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS2078, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24963040

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529505249.

Catsper4 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL2872, 4124 (ID_REF), GDS3259, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52950524

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10923965710.

Catsper4 - Diabetic db/db heart response to rosiglitazone

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL4134, 29757 (ID_REF), GDS4990, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109239657

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4559025911.

Catsper4 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL4636, 8159 (ID_REF), GDS2976, NM_177866

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45590259

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8245175312.

Catsper4 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2591842 (ID_REF), GDS3720, NM_177866

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82451753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5179222413.

Catsper4 - Interleukin-22 effect on colon cultures

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL2872, 4124 (ID_REF), GDS3226, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51792224

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13043444614.

Catsper4 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P234440 (ID_REF), GDS5666, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130434446

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12574776715.

Catsper4 - Commensal bacteria colonization effect on gnotobiotic model of food allergy: colonic epithelial cells

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2991970 (ID_REF), GDS5424, NM_177866

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125747767

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5539334016.

Catsper4 - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS3386, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55393340

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4418334017.

Catsper4 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS2924, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44183340

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2797204018.

Catsper4 - Estradiol effect on the uterus: time course

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL891, 17640 (ID_REF), GDS2208, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27972040

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10561941419.

Catsper4 - Acute cold exposure effect on skeletal muscle

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2591842 (ID_REF), GDS4849, NM_177866

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 105619414

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12845184620.

Catsper4 - Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Catsper4, cation channel, sperm associated 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P234440 (ID_REF), GDS5612, NM_177866, A_51_P234440 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128451846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 194097449) (297)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 297

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity