GEO Profiles Links for Nucleotide (Select 21594815) - GEO Profiles

Links from Nucleotide

Items: 1 to 20 of 153

<< First< Prev

Page of 8

Next >Last >>

Select item 44825491.

Dcun1d4 - Zygotic gene activation

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 13449 (ID_REF), GDS579, AK008561, AK049672, BC031793, J0037D05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4482549

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 968381282.

Dcun1d4 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4486, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96838128

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922024283.

Dcun1d4 - 16p11.2 copy number variation models: various brain regions

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4430, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 37 samples

ID:: 92202428

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 974365284.

Dcun1d4 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4517, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97436528

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 875019285.

Dcun1d4 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4317, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87501928

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1101103286.

Dcun1d4 - Induced myeloproliferative neoplasm effect on Scl-tTA::TRE-BCR/ABL double-transgenic model of chronic myeloid leukemia: osteoblastic lineage cells

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS5024, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 110110328

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44592497.

Dcun1d4 - Preimplantation development

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 13449 (ID_REF), GDS578, AK008561, AK049672, BC031793, J0037D05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4459249

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1181647288.

Dcun1d4 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS5226, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118164728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1029326289.

Dcun1d4 - Liver response to a high fat diet: time course

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4783, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102932628

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12910222810.

Dcun1d4 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS5628, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129102228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6665432811.

Dcun1d4 - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS3748, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66654328

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8122272812.

Dcun1d4 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4162, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81222728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11480122813.

Dcun1d4 - Kidney epithelium cell line response to adaptive mutations in Influenza A virus (H3N2) non-structural 1 gene

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4996, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 42 samples

ID:: 114801228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13187272814.

Dcun1d4 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS5824, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131872728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7510722815.

Dcun1d4 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS3987, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75107228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749490416.

Dcun1d4 - MPSS transcriptome analysis project

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCAAGAGCACTTATG (ID_REF), GDS868, BC031793

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7494904

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12974992817.

Dcun1d4 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS5645, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129749928

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8487922818.

Dcun1d4 - Ts65Dn aneuploidy model of Down syndrome: skeletal muscle

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS4376, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 84879228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7538472819.

Dcun1d4 - Developing testis and ovary

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS3995, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75384728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11890692820.

Dcun1d4 - Mmp-8 deficient ankle joint response to the induction of arthritis

Annotation:: Dcun1d4, DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10522430 (ID_REF), GDS5243, NM_001190733, NM_001190734, NM_178896, XM_006503629, XM_006503631, XM_006503636, XM_006503637, XR_376792, AK076991, BC031793, BC108346, BC137627, BC137628, BC144794, XM_006503628, XM_006503633, chr5:73481055-73560790 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118906928

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 153

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity