GEO Profiles Links for Nucleotide (Select 22359864) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 21

<< First< Prev

Page of 2

Next >Last >>

Select item 728390081.

Spatial and temporal development of mammalian salivary glands

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS3922, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72839008

GEO DataSets

Select item 715408082.

Interstrain differences in the liver effects of trichloroethylene

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS3890, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71540808

GEO DataSets Profile neighbors

Select item 1194050083.

Chronic, low level drug exposure effect on obese liver

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5258, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119405008

GEO DataSets Profile neighbors

Select item 1304491084.

4T1 breast cancer model: metastatic sub-populations

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5666, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130449108

GEO DataSets Profile neighbors

Select item 1226718085.

T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5343, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122671808

GEO DataSets Profile neighbors

Select item 1284239086.

Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5611, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128423908

GEO DataSets Profile neighbors

Select item 1316423087.

Normal liver developmental stages: embryonic and postnatal

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5818, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131642308

GEO DataSets Profile neighbors

Select item 750665088.

High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS3986, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75066508

GEO DataSets Profile neighbors

Select item 1284665089.

Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5612, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128466508

GEO DataSets Profile neighbors

Select item 12914080810.

Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5629, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129140808

GEO DataSets Profile neighbors

Select item 1877517111.

MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL2897, 88027 (ID_REF), GDS1729, BQ944386

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18775171

GEO DataSets Profile neighbors

Select item 750493612.

MPSS transcriptome analysis project

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCTGGAAACAGGAGA (ID_REF), GDS868, BQ944386

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7504936

GEO DataSets

Select item 11967810813.

High-fat diet effect on obesity-resistant NAG-1 transgenics: colon epithelium

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5264, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 119678108

GEO DataSets Profile neighbors

Select item 12091760814.

T helper type 9 cells

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5291, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120917608

GEO DataSets Profile neighbors

Select item 4140277115.

Nephronophthisis model

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL2897, 88027 (ID_REF), GDS2817, BQ944386

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41402771

GEO DataSets Profile neighbors

Select item 6405150816.

SIRT1 deficiency effect on the liver

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS3666, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64051508

GEO DataSets Profile neighbors

Select item 11825290817.

Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5228, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 118252908

GEO DataSets Profile neighbors

Select item 4680516918.

Dicer inactivation effect on the embryonic heart

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL5025, 7669 (ID_REF), GDS3033, BQ944386

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46805169

GEO DataSets Profile neighbors

Select item 13231840819.

Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS6016, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132318408

GEO DataSets Profile neighbors

Select item 11883190820.

Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P1173329 (ID_REF), GDS5241, BQ944386, A_52_P1173329 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118831908

GEO DataSets Profile neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 22359864) (21)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 21

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity