GEO Profiles Links for Nucleotide (Select 26080983) - GEO Profiles - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 8

Select item 978747951.

Value/Rank Plot

Ankrd35 - Atherosclerosis susceptibility model: macrophages

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL9734, 100105272_TGI_at (ID_REF), GDS4527, AK028691

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97874795

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971617952.

Value/Rank Plot

Ankrd35 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL9734, 100105272_TGI_at (ID_REF), GDS4495, AK028691

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97161795

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644813953.

Value/Rank Plot

Ankrd35 - Hypertension model: kidney

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL9734, 100105272_TGI_at (ID_REF), GDS3675, AK028691

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64481395

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644417954.

Value/Rank Plot

Ankrd35 - Hypertension model: liver

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL9734, 100105272_TGI_at (ID_REF), GDS3674, AK028691

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64441795

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644021955.

Value/Rank Plot

Ankrd35 - Hypertension model: heart

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL9734, 100105272_TGI_at (ID_REF), GDS3673, AK028691

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64402195

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643625956.

Value/Rank Plot

Ankrd35 - Hypertension model: aorta

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL9734, 100105272_TGI_at (ID_REF), GDS3672, AK028691

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64362595

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76102257.

Value/Rank Plot

Ankrd35 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTCCACATACAGGA (ID_REF), GDS878, AK028691

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7610225

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 74725258.

Value/Rank Plot

Ankrd35 - MPSS transcriptome analysis project

Annotation:: Ankrd35, ankyrin repeat domain 35

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTCCACATACAGGA (ID_REF), GDS868, AK028691

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7472525

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26080983) (8)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles