GEO Profiles Links for Nucleotide (Select 26090786) - GEO Profiles - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 5

Select item 468315601.

Value/Rank Plot

Dicer inactivation effect on the embryonic heart

Annotation:: Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130049J04 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL5025, 34060 (ID_REF), GDS3033, AK045227

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46831560

GEO DataSets Profile neighbors

Select item 414361292.

Value/Rank Plot

Nephronophthisis model

Annotation:: Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130049J04 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL2897, 386009 (ID_REF), GDS2817, AK045227

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41436129

GEO DataSets Profile neighbors

Select item 74846603.

Value/Rank Plot

MPSS transcriptome analysis project

Annotation:: Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130049J04 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCAACCAGTAGGTCTCAA (ID_REF), GDS868, AK045227

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7484660

Select item 76223604.

Value/Rank Plot

MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130049J04 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCAACCAGTAGGTCTCAA (ID_REF), GDS878, AK045227

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7622360

Select item 188085295.

Value/Rank Plot

MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130049J04 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL2897, 386009 (ID_REF), GDS1729, AK045227

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18808529

GEO DataSets Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26090786) (5)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles