GEO Profiles Links for Nucleotide (Select 26094989) - GEO Profiles - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 8

Select item 971385811.

Value/Rank Plot

Celf2 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100094285_TGI_at (ID_REF), GDS4495, AK052102

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97138581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643789812.

Value/Rank Plot

Celf2 - Hypertension model: heart

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100094285_TGI_at (ID_REF), GDS3673, AK052102

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64378981

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643393813.

Value/Rank Plot

Celf2 - Hypertension model: aorta

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100094285_TGI_at (ID_REF), GDS3672, AK052102

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64339381

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 978515814.

Value/Rank Plot

Celf2 - Atherosclerosis susceptibility model: macrophages

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100094285_TGI_at (ID_REF), GDS4527, AK052102

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97851581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75186695.

Value/Rank Plot

Celf2 - MPSS transcriptome analysis project

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGAACTGCTCCTTGCT (ID_REF), GDS868, AK052102

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7518669

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 644581816.

Value/Rank Plot

Celf2 - Hypertension model: kidney

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100094285_TGI_at (ID_REF), GDS3675, AK052102

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64458181

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644185817.

Value/Rank Plot

Celf2 - Hypertension model: liver

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL9734, 100094285_TGI_at (ID_REF), GDS3674, AK052102

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64418581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76563698.

Value/Rank Plot

Celf2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Celf2, CUGBP, Elav-like family member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGAACTGCTCCTTGCT (ID_REF), GDS878, AK052102

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7656369

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26094989) (8)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles