GEO Profiles Links for Nucleotide (Select 26102102) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 31

<< First< Prev

Page of 2

Next >Last >>

Select item 44872501.

9030624J02Rik - Zygotic gene activation

Annotation:: 9030624J02Rik, RIKEN cDNA 9030624J02 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 18150 (ID_REF), GDS579, AK011615, AK018573, AK050302, AK084607, BC007154, BC025808, BC038055, BC043674, L06865, L0065C11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4487250

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 715458902.

Knop1 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS3890, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71545890

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 76122063.

Knop1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCCTGTCTCTACCTC (ID_REF), GDS878, AK084607

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7612206

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226768904.

Knop1 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5343, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122676890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728440905.

Knop1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS3922, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72844090

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1316473906.

Knop1 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5818, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131647390

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74745067.

Knop1 - MPSS transcriptome analysis project

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCCTGTCTCTACCTC (ID_REF), GDS868, AK084607

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7474506

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1284715908.

Knop1 - Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5612, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128471590

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1182579909.

Knop1 - Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5228, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 118257990

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6405659010.

Knop1 - SIRT1 deficiency effect on the liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS3666, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64056590

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12842899011.

Knop1 - Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5611, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128428990

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446395012.

9030624J02Rik - Preimplantation development

Annotation:: 9030624J02Rik, RIKEN cDNA 9030624J02 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 18150 (ID_REF), GDS578, AK011615, AK018573, AK050302, AK084607, BC007154, BC025808, BC038055, BC043674, L06865, L0065C11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4463950

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11528824513.

Knop1 - Glucocorticoid effect on the male liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 37145 (ID_REF), GDS5035, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115288245

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12231444514.

Knop1 - Industrial pollution effect on liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 37145 (ID_REF), GDS5331, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122314445

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3188721815.

Knop1 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL2872, 12818 (ID_REF), GDS2413, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31887218

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11533484516.

Knop1 - Glucocorticoid effect on the female liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 37145 (ID_REF), GDS5036, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115334845

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13045419017.

Knop1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5666, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130454190

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5520944518.

Knop1 - Iron enriched and deficient diets effect on the liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 37145 (ID_REF), GDS3373, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55209445

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11941009019.

Knop1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P277322 (ID_REF), GDS5258, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119410090

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12707034520.

Knop1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Knop1, lysine rich nucleolar protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 37145 (ID_REF), GDS5461, AK084607, A_52_P277322 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127070345

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26102102) (31)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 31

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity