GEO Profiles Links for Nucleotide (Select 26102479) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 9

Select item 468279621.

Dicer inactivation effect on the embryonic heart

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL5025, 30462 (ID_REF), GDS3033, AK085126

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46827962

GEO DataSets Profile neighbors

Select item 978412252.

Atherosclerosis susceptibility model: macrophages

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100093620_TGI_at (ID_REF), GDS4527, AK085126

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97841225

GEO DataSets Profile neighbors

Select item 75012613.

MPSS transcriptome analysis project

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCACAAACTTGTTCAA (ID_REF), GDS868, AK085126

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7501261

GEO DataSets

Select item 76389614.

MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCACAAACTTGTTCAA (ID_REF), GDS878, AK085126

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7638961

GEO DataSets

Select item 643290255.

Hypertension model: aorta

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100093620_TGI_at (ID_REF), GDS3672, AK085126

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64329025

GEO DataSets Profile neighbors

Select item 971282256.

SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100093620_TGI_at (ID_REF), GDS4495, AK085126

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97128225

GEO DataSets Profile neighbors

Select item 643686257.

Hypertension model: heart

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100093620_TGI_at (ID_REF), GDS3673, AK085126

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64368625

GEO DataSets Profile neighbors

Select item 644082258.

Hypertension model: liver

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100093620_TGI_at (ID_REF), GDS3674, AK085126

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64408225

GEO DataSets Profile neighbors

Select item 644478259.

Hypertension model: kidney

Annotation:: Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430040L24 product:unclassifiable, full insert sequence