GEO Profiles Links for Nucleotide (Select 26102820) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 19

Select item 414119541.

Tmem52b - Nephronophthisis model

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL2897, 170026 (ID_REF), GDS2817, AK085571

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41411954

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 176935732.

Tmem52b - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS1675, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17693573

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 46466733.

Tmem52b - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22409_a_at (ID_REF), GDS592, D630042F21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4646673

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 303131734.

Tmem52b - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22409_a_at (ID_REF), GDS2327, D630042F21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30313173

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 187843545.

Tmem52b - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL2897, 170026 (ID_REF), GDS1729, AK085571

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18784354

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553838736.

Tmem52b - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS3386, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55383873

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441738737.

Tmem52b - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS2924, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44173873

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249535738.

Tmem52b - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS2078, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24953573

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 63307739.

Tmem52b - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS775, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6330773

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299207310.

Tmem52b - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS1359, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12992073

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 595747311.

Tmem52b - High fat diet effect on aorta: time course

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS735, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5957473

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2493027312.

Tmem52b - Estren effect on the uterus: time course

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS2077, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24930273

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4681244313.

Tmem52b - Dicer inactivation effect on the embryonic heart

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL5025, 14943 (ID_REF), GDS3033, AK085571

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46812443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 464667214.

Tmem52b - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22408_at (ID_REF), GDS592, D630042F21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4646672

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3031317215.

Tmem52b - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22408_at (ID_REF), GDS2327, D630042F21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30313172

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2796257316.

Tmem52b - Estradiol effect on the uterus: time course

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS2208, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27962573

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1301537317.

Tmem52b - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL891, 8173 (ID_REF), GDS1360, AK085571, A_51_P410129 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13015373

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 760897818.

Tmem52b - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAGTGCCTGGGCAAG (ID_REF), GDS878, AK085571

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7608978

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 747127819.

Tmem52b - MPSS transcriptome analysis project

Annotation:: Tmem52b, transmembrane protein 52B

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAGTGCCTGGGCAAG (ID_REF), GDS868, AK085571

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7471278

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26102820) (19)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 19

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity