GEO Profiles Links for Nucleotide (Select 26330010) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 49

<< First< Prev

Page of 3

Next >Last >>

Select item 826127601.

Effects of high-fat maternal diet and transcription factor Cited2 deficiency on embryos

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS3724, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 82612760

GEO DataSets Profile neighbors

Select item 1167604602.

Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5185, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116760460

GEO DataSets Profile neighbors

Select item 824861253.

ROR alpha1 deletion effect on skeletal muscle

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1217304 (ID_REF), GDS3720, AK034531

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82486125

GEO DataSets Profile neighbors

Select item 46439624.

Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m19698_at (ID_REF), GDS592, 9430001M03 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4643962

GEO DataSets

Select item 653245255.

Addictive drugs effect on brain striatum: time course

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1217304 (ID_REF), GDS3703, AK034531

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65324525

GEO DataSets

Select item 75227346.

MPSS transcriptome analysis project

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGCCATAATGTTCC (ID_REF), GDS868, AK034531

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7522734

GEO DataSets

Select item 1159409607.

Auditory fear conditioning effect on amygdala: time course

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5157, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115940960

GEO DataSets Profile neighbors

Select item 1317980608.

αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5821, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131798060

GEO DataSets Profile neighbors

Select item 303104629.

Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m19698_at (ID_REF), GDS2327, 9430001M03 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30310462

GEO DataSets Profile neighbors

Select item 13184476010.

Anti-CTLA-4 immunotherapy effect on αSMA+ myofibroblast late-depleted pancreatic ductal adenocarcinoma model

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5822, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 131844760

GEO DataSets Profile neighbors

Select item 7565921811.

High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6481, 106040731 (ID_REF), GDS4002, AK034531, 9430001M03Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75659218

GEO DataSets Profile neighbors

Select item 6622482512.

X chromosome dosage model

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1217304 (ID_REF), GDS3728, AK034531

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66224825

GEO DataSets Profile neighbors

Select item 12334976013.

Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5360, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123349760

GEO DataSets Profile neighbors

Select item 12774696014.

Rosiglitazone effect on adipose progenitor cells

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5520, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127746960

GEO DataSets Profile neighbors

Select item 13175136015.

αSMA+ myofibroblast early depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5820, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131751360

GEO DataSets Profile neighbors

Select item 12005396016.

Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5271, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 120053960

GEO DataSets Profile neighbors

Select item 12112256017.

Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5295, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121122560

GEO DataSets Profile neighbors

Select item 11865266018.

20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1217304 (ID_REF), GDS5237, AK034531, 9430001M03RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118652660

GEO DataSets Profile neighbors

Select item 6256099119.

Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6333, ri|9430001M03|PX00108M07|AK034531|1886-S (ID_REF), GDS3621, AK034531, 9430001M03Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62560991

GEO DataSets Profile neighbors

Select item 12985496020.

Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430001M03 product:unclassifiable, full insert sequence