GEO Profiles Links for Nucleotide (Select 26343960) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 17

Select item 61488651.

Dlst - Blastocyst dormancy and activation comparison

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12565 (ID_REF), GDS752, AK019713, AK054053, BC006702, BC024066, AK051939, H3146E02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6148865

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 44816652.

Dlst - Zygotic gene activation

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12565 (ID_REF), GDS579, AK019713, AK054053, BC006702, BC024066, AK051939, H3146E02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4481665

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 44461153.

Dlst - Preimplantation development

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 315 (ID_REF), GDS578, AK019713, AK054053, BC006702, BC024066, AK051939, C0100C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4446115

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 44583654.

Dlst - Preimplantation development

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12565 (ID_REF), GDS578, AK019713, AK054053, BC006702, BC024066, AK051939, H3146E02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4458365

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 206409805.

Dlst - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL3222, M300000603 (ID_REF), GDS1826, NM_030225, AK054053

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20640980

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61420206.

Dlst - Blastocyst dormancy and activation comparison

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 5720 (ID_REF), GDS752, AK019713, AK054053, BC006702, BC024066, AK051939, H3006F03-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6142020

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 61366157.

Dlst - Blastocyst dormancy and activation comparison

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 315 (ID_REF), GDS752, AK019713, AK054053, BC006702, BC024066, AK051939, C0100C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6136615

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1125183468.

Dlst - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL4783, M300000603 (ID_REF), GDS2645, NM_030225, AK054053

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112518346

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206409799.

Dlst - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL3222, M200005966 (ID_REF), GDS1826, NM_030225, AK054053

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20640979

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2064097810.

Dlst - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL3222, M300000604 (ID_REF), GDS1826, NM_030225, AK054053

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20640978

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11251834711.

Dlst - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL4783, M300000604 (ID_REF), GDS2645, NM_030225, AK054053

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112518347

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 446941512.

Dlst - Zygotic gene activation

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 315 (ID_REF), GDS579, AK019713, AK054053, BC006702, BC024066, AK051939, C0100C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4469415

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11251226213.

Dlst - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL4783, M200005966 (ID_REF), GDS2645, NM_030225, AK054053

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112512262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447482014.

Dlst - Zygotic gene activation

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 5720 (ID_REF), GDS579, AK019713, AK054053, BC006702, BC024066, AK051939, H3006F03-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4474820

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445152015.

Dlst - Preimplantation development

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 5720 (ID_REF), GDS578, AK019713, AK054053, BC006702, BC024066, AK051939, H3006F03-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4451520

GEO DataSets Gene Chromosome neighbors

Select item 764261816.

Dlst - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGCTGAAGAGAGCTT (ID_REF), GDS878, AK054053

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7642618

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 750491817.

Dlst - MPSS transcriptome analysis project

Annotation:: Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGCTGAAGAGAGCTT (ID_REF), GDS868, AK054053

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7504918

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26343960) (17)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 17

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity