GEO Profiles Links for Nucleotide (Select 4614741) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 35

<< First< Prev

Page of 2

Next >Last >>

Select item 303591831.

Acute myocardial infarction model: time course (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS2331, AI605574

DataSet type:: Expression profiling by array, count, 66 samples

ID:: 30359183

GEO DataSets Profile neighbors

Select item 126580832.

T cell anergy induction regulation by Egr-2 and Egr-3 (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS1339, AI605574

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 12658083

GEO DataSets Profile neighbors

Select item 447905833.

Pancreatic development (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS2950, AI605574

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 44790583

GEO DataSets Profile neighbors

Select item 74830534.

MPSS transcriptome analysis project

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGCTAAGGTTGAGCA (ID_REF), GDS868, AI605574

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483053

GEO DataSets

Select item 26840835.

Spermatogenesis time course (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS410, AI605574

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2684083

GEO DataSets Profile neighbors

Select item 47895836.

Spermatogenesis and testis development time course (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS607, AI605574

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4789583

GEO DataSets Profile neighbors

Select item 224270837.

Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS1936, AI605574

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 22427083

GEO DataSets Profile neighbors

Select item 41708838.

Mesangioblast stem cell clone comparison (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS555, AI605574

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 4170883

GEO DataSets Profile neighbors

Select item 29750839.

Stem cell self renewal and Bmi-1 (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS430, AI605574

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 2975083

GEO DataSets Profile neighbors

Select item 2322328310.

Primary visual cortex response to visual input deprivation (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS1986, AI605574

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23223283

GEO DataSets Profile neighbors

Select item 700418311.

Spermatogonia in Zfp145 knockout (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS837, AI605574

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 7004183

GEO DataSets Profile neighbors

Select item 126538312.

Hyperoxic lung injury (U74Cv2)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS249, AI605574

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 1265383

GEO DataSets Profile neighbors

Select item 1650078313.

Follicular dendritic cell enriched splenocytes (MG U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS1600, AI605574

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 16500783

GEO DataSets Profile neighbors

Select item 2151108314.

Myotube response to PGC-1alpha induced mitochondrial biogenesis: time course (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS1880, AI605574

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 21511083

GEO DataSets Profile neighbors

Select item 36348315.

Allergic response to ragweed in lung (U74Cv2)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS60, AI605574

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 363483

GEO DataSets Profile neighbors

Select item 2953058316.

Uniparental duplication of chromosome 7 regions effect on various tissues (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS2285, AI605574

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 29530583

GEO DataSets Profile neighbors

Select item 2324848317.

Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS1988, AI605574

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23248483

GEO DataSets Profile neighbors

Select item 5530578318.

Visual cortex during the critical period for ocular dominance (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS3382, AI605574

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55305783

GEO DataSets Profile neighbors

Select item 5719528319.

Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74C)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS3446, AI605574

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57195283

GEO DataSets Profile neighbors

Select item 9325158320.

Endothelial cells from P8 neonatal retina [MG_U74Cv2]

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL83, 140814_at (ID_REF), GDS4463, AI605574

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93251583

GEO DataSets Profile neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 4614741) (35)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 35

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity