GEO Profiles Links for Nucleotide (Select 7671225) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 12

Select item 1125239441.

Kcnq4 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL4783, M300006201 (ID_REF), GDS2645, AF249747

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112523944

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 716695712.

Kcnq4 - Fasting effect on multiple tissues: time course

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL11012, 4071 (ID_REF), GDS3893, AF249747

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71669571

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 499544873.

Kcnq4 - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL1536, 1230721_1 (ID_REF), GDS3148, AF249747

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49954487

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 296726724.

Kcnq4 - Atherogenic diet effect on the liver: time course

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL1292, AGmmB240712 (ID_REF), GDS2292, AF249747

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29672672

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 285241805.

Kcnq4 - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL2987, 11480 (ID_REF), GDS2227, AF249747

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28524180

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215565246.

Kcnq4 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL1942, 6524 (ID_REF), GDS1882, AF249747

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21556524

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215565237.

Kcnq4 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL1942, 6523 (ID_REF), GDS1882, AF249747

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21556523

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206509268.

Kcnq4 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL3222, M300006201 (ID_REF), GDS1826, AF249747

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20650926

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 91915619.

Kcnq4 - Skeletal muscle response to voluntary running: time course

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL254, 13858 (ID_REF), GDS1019, AF249747

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9191561

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 762876010.

Kcnq4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCTGCTGGGCTTCTA (ID_REF), GDS878, AF249747

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7628760

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 749106011.

Kcnq4 - MPSS transcriptome analysis project

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCTGCTGGGCTTCTA (ID_REF), GDS868, AF249747

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7491060

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 450456112.

Kcnq4 - Glomerulonephropathy

Annotation:: Kcnq4, potassium voltage-gated channel, subfamily Q, member 4

Organism:: Mus musculus

Reporter:: GPL254, 13858 (ID_REF), GDS580, AF249747

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 4504561

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 7671225) (12)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 12

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity