GEO Profiles Links for Nucleotide (Select 93102408) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 332

<< First< Prev

Page of 17

Next >Last >>

Select item 1153009721.

Fasn - Glucocorticoid effect on the female liver

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL4134, 3272 (ID_REF), GDS5036, NM_007988, A_51_P321126 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115300972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1029187312.

Fasn - Liver response to a high fat diet: time course

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6246, 10393970 (ID_REF), GDS4783, NM_007988, AF127033, BC046513, chr11:120805958-120824547 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102918731

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152543723.

Fasn - Glucocorticoid effect on the male liver

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL4134, 3272 (ID_REF), GDS5035, NM_007988, A_51_P321126 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115254372

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640407374.

Fasn - SIRT1 deficiency effect on the liver

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P321126 (ID_REF), GDS3666, NM_007988, A_51_P321126 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64040737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625742975.

Fasn - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6333, scl014104.1_1-S (ID_REF), GDS3621, NM_007988, Fasn (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62574297

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750557376.

Fasn - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P321126 (ID_REF), GDS3986, NM_007988, A_51_P321126 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75055737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303482727.

Fasn - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL4134, 3272 (ID_REF), GDS5664, NM_007988, A_51_P321126 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130348272

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 301475528.

Fasn - High and low weight gainers: adipose tissue

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL2995, 596044 (ID_REF), GDS2319, NM_007988

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30147552

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318588319.

Fasn - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6246, 10393970 (ID_REF), GDS5824, NM_007988, AF127033, BC046513, chr11:120805958-120824547 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131858831

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5964407610.

Fasn - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2638055 (ID_REF), GDS3522, NM_007988

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59644076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8246947611.

Fasn - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2638055 (ID_REF), GDS3720, NM_007988

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82469476

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9275833112.

Fasn - Neurofibromin inactivation effect on triceps muscle

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6246, 10393970 (ID_REF), GDS4447, NM_007988, AF127033, BC046513, chr11:120805958-120824547 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 92758331

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11815083113.

Fasn - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6246, 10393970 (ID_REF), GDS5226, NM_007988, AF127033, BC046513, chr11:120805958-120824547 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118150831

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749071014.

Fasn - MPSS transcriptome analysis project

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCACAATTAAACTGCA (ID_REF), GDS868, NM_007988

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7490710

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10566345715.

Fasn - Acute cold exposure effect on brown adipose tissue

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2638055 (ID_REF), GDS4850, NM_007988

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 105663457

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4694006916.

Fasn - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL4234, 430717 (ID_REF), GDS3037, NM_007988

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46940069

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6197389717.

Fasn - Eset depletion effect on embryonic stem cell

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6333, scl014104.1_1-S (ID_REF), GDS3599, NM_007988, Fasn (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61973897

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13164071718.

Fasn - Normal liver developmental stages: embryonic and postnatal

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P100252 (ID_REF), GDS5818, NM_007988, A_52_P100252 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131640717

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10548153119.

Fasn - Streptozotocin induced type 1 diabetes: liver

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6246, 10393970 (ID_REF), GDS4845, NM_007988, AF127033, BC046513, chr11:120805958-120824547 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 105481531

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11602965720.

Fasn - Lung response to highly virulent or low virulent influenza A H3N2 virus infection: time course

Annotation:: Fasn, fatty acid synthase

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2638055 (ID_REF), GDS5159, NM_007988

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 116029657

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 17

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 93102408) (332)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 332

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity