GEO Profile Links for PMC (Select 86124) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from PMC

Items: 1 to 20 of 8422

<< First< Prev

Page of 422

Next >Last >>

Select item 1296728621.

Col2a1 - Tendon development: embryonic limb tendon cells

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS5642, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 129672862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 686394622.

Col2a1 - TNF receptor and lymphotoxin beta -receptor activation effect on aortic smooth muscle cells in vitro: time course

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS3809, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 68639462

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 658565623.

Col2a1 - Embryonic brain development

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS3442, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 65856562

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 583072624.

Col2a1 - Zinc transporter SLC39A13 deficiency effect on chondrocytes

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS3485, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 58307262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 410482625.

Col2a1 - Dexamethasone effect on fetal chondrocytes in vitro: time course

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS2802, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41048262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 410199596.

Col10a1 - Dexamethasone effect on fetal chondrocytes in vitro: time course

Annotation:: Col10a1, collagen, type X, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1422253_at (ID_REF), GDS2802, 12813 (Gene ID), NM_009925

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41019959

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 255408627.

Col2a1 - Testis development

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS2098, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 25540862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 195259308.

Col2a1 - B-form DNA transfection effect on TBK1 and IKKi deficient embryonic fibroblasts

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL339, 1450567_a_at (ID_REF), GDS1773, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 19525930

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75237239.

Col2a1 - MPSS transcriptome analysis project

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCACTGAATGGCTGA (ID_REF), GDS868, BC030913

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7523723

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12529075910.

Col10a1 - Age effect on respiratory epithelium: distal trachea and carina region

Annotation:: Col10a1, collagen, type X, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1422253_at (ID_REF), GDS5412, 12813 (Gene ID), NM_009925

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125290759

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9914149611.

MINPP1 - CD34+derived erythoblast co-culture with Plasmodium falciparum 3D7 (Dchip analysis)

Annotation:: MINPP1, multiple inositol-polyphosphate phosphatase 1

Organism:: Homo sapiens

Reporter:: GPL570, 209585_s_at (ID_REF), GDS4558, 9562 (Gene ID), AF084943

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99141496

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8295279612.

MINPP1 - Imatinib treatment of chronic myeloid leukemia cell lines: KU-812, KCL-22 and JURL-MK1

Annotation:: MINPP1, multiple inositol-polyphosphate phosphatase 1

Organism:: Homo sapiens

Reporter:: GPL570, 209585_s_at (ID_REF), GDS4177, 9562 (Gene ID), AF084943

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 82952796

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7330119613.

MINPP1 - Primary erythroblast culture response to cytokine-induced increase in fetal hemoglobin

Annotation:: MINPP1, multiple inositol-polyphosphate phosphatase 1

Organism:: Homo sapiens

Reporter:: GPL570, 209585_s_at (ID_REF), GDS3936, 9562 (Gene ID), AF084943

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 73301196

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4988886214.

Col2a1 - Various tissues

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS3142, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49888862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3870918215.

Minpp1 - Transcription factor Zfx deficiency effect on embryonic and hematopoietic stem cells

Annotation:: Minpp1, multiple inositol polyphosphate histidine phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1455787_x_at (ID_REF), GDS2718, 17330 (Gene ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 38709182

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2950743016.

Col2a1 - Uniparental duplication of chromosome 7 regions effect on embryo and newborn brain (MG-430A)

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL339, 1450567_a_at (ID_REF), GDS2283, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 29507430

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2734152217.

MINPP1 - M-CSF and GM-CSF differentiated macrophages response to bacillus Calmette-Guerin (Subset A)

Annotation:: MINPP1, multiple inositol-polyphosphate phosphatase 1

Organism:: Homo sapiens

Reporter:: GPL1293, AGhsA190110 (ID_REF), GDS2180, 9562 (Gene ID), NM_004897

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 27341522

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2130163018.

Col2a1 - Chondrocyte differentiation: time course

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL339, 1450567_a_at (ID_REF), GDS1865, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 21301630

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11509876219.

Col2a1 - Mammalian heart development: time course

Annotation:: Col2a1, collagen, type II, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450567_a_at (ID_REF), GDS5003, 12824 (Gene ID), NM_031163

DataSet type:: Expression profiling by array, transformed count, 45 samples

ID:: 115098762

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11432964820.

Col10a1 - FG-3019/gemcitabine combined-treatment effect on KPC model of pancreatic ductal adenocarcinoma

Annotation:: Col10a1, collagen, type X, alpha 1

Organism:: Mus musculus

Reporter:: GPL8321, 1422253_at (ID_REF), GDS4945, 12813 (Gene ID), NM_009925

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 114329648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 422

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for PMC (Select 86124) (8422)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from PMC

Items: 1 to 20 of 8422

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity