Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: CK790536.1
FASTA Graphics
LOCUS CK790536 797 bp mRNA linear EST 25-FEB-2004 DEFINITION AGENCOURT_18672698 NIH_MGC_189 Mus musculus cDNA clone IMAGE:30840140 5', mRNA sequence. ACCESSION CK790536 VERSION CK790536.1 DBLINK BioSample: SAMN00174735 KEYWORDS EST. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 797) CONSRTM National Institutes of Health, Mammalian Gene Collection (MGC) TITLE NIH-MGC EST Sequencing Project JOURNAL Unpublished REMARK http://mgc.nci.nih.gov/ COMMENT Contact: Daniela S. Gerhard, Ph.D. Office of Cancer Genomics National Cancer Institute / NIH Bldg. 31 Rm10A07 Bethesda, MD 20892 Email: cgapbs-r@mail.nih.gov Tissue Procurement: Shioko Kimura/Atsushi Yamada, (NCI,CCR) cDNA Library Preparation: Express Genomics cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL) DNA Sequencing by: Agencourt Bioscience Corporation Clone distribution: MGC clone distribution information can be found through the I.M.A.G.E. Consortium/LLNL at: http://image.llnl.gov Plate: NDAM1133 row: b column: 21 High quality sequence stop: 608. FEATURES Location/Qualifiers source 1..797 /organism="Mus musculus" /mol_type="mRNA" /db_xref="taxon:10090" /clone="IMAGE:30840140" /tissue_type="Pooled thyroids from 5 mice" /clone_lib="SAMN00174735 NIH_MGC_189" /lab_host="DH10B TonA" /note="Organ: thyroid; Vector: pExpress-1; Site_1: NotI; Site_2: NotI; RNA obtained from 5 normal wild-type mice. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_230) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library" ORIGIN 1 ggattcccgg gattacagag ttaatgactt gatccccttc aagggtgcat aaaatagtca 61 ggaattcagc tagctgttta ataaataatg cattaggaac atttctaaag cccggtgaag 121 tggtgcatac ctgtcatccc agcaattcag aagctgaggc aggaggatta ctatgagtgt 181 acagccagcc tgggccatgt aacaagactc tgcttcaaac aaaacctatt ttaagtatgt 241 aatgagtaat tcctatgtta cactttaaag acaaaagtgt tgtgagcatg cttcggaagt 301 cattttctaa acatgtctag aaagccatta cgcagactaa agtagagatg catcatcctt 361 tcaaagcaca gactgggaag gcctttgtgt tataaccatc ataagtcaac agcctaagct 421 atgactcaat acctcgaaac aattgctgct acttcatgca aggattttaa atgtcgagtt 481 aggtgatttc ctgatagttc aatcatccct gagccttaaa atgttctctc tcttgaaagc 541 ttcatcagaa tgaaattctc tctagtttgc ttgggtgtac acatatctgg tccacaggga 601 acctgaagat ggtcacacac atacacctcc cataagatgt aatattcctt cactttctac 661 tatgcgcttt tttttctact agctgaaaag ttccttttat cangtgtaac tactgatgct 721 gtggtgtatt ggacactagc antaaaacgt gaagagaaaa aaaaaaaaaa aaaaaaaagg 781 cgcgctatac tcagatg //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on