Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: D20546.1
FASTA Graphics
LOCUS D20546 107 bp mRNA linear EST 11-MAR-2009 DEFINITION HUMGS01521 Human promyelocyte Homo sapiens cDNA clone pm2785 3', mRNA sequence. ACCESSION D20546 VERSION D20546.1 DBLINK BioSample: SAMN00154737 KEYWORDS EST. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 107) AUTHORS Murakawa,K., Matsubara,K., Fukushima,A., Yoshii,J. and Okubo,K. TITLE Chromosomal assignments of 3'-directed partial cDNA sequences representing novel genes expressed in granulocytoid cells JOURNAL Genomics 23, 379-389 (1994) PUBMED 7835887 REFERENCE 2 (bases 1 to 107) AUTHORS Okubo,K., Itoh,K., Fukushima,A., Yoshii,J. and Matsubara,K. TITLE Monitoring cell physiology by expression profiles and discovering cell type-specific genes by compiled expression profiles JOURNAL Genomics 30 (2), 178-186 (1995) PUBMED 8586417 COMMENT Contact: Kousaku Okubo Laboratory for Gene-Expression Analysis National Institute of Genetics 1111 Yata, Mishima, Shizuoka 411-8540, Japan DDBJ CHROMOSOMAL_ASSIGNMENT :method='PCR WITH HYBRID CELL PANEL' ::primer_f='CCCAAATCAAATTGTTAAATG' ::primer_r='TTTGAATCAGAGACATGAAGTT' ::background='mouse:1,2,5,6,7,8,10,11,12,14,15,16,17,18,19, 20,21,X' ::background='chinese hamster:3,4,9,13,22,Y' :chromosome='1' 3'-EST sequences are presented as sense strand. FEATURES Location/Qualifiers source 1..107 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /map="1" /clone="pm2785" /clone_lib="SAMN00154737 Human promyelocyte" /note="Female, adult, cell_line = HL60, cell_type = promyelocyte." ORIGIN 1 gatccaaccc aaatcaaatt gttaaatgcc ctcttgaatt tttttgtctg ttatttaatt 61 atatggtgga attaataata aaataaactt catgtctctg attcaaa //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on