Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: T16175.1
FASTA Graphics
LOCUS T16175 365 bp mRNA linear EST 25-JAN-2011 DEFINITION IB3656 Infant brain, Bento Soares Homo sapiens cDNA 3'end, mRNA sequence. ACCESSION T16175 VERSION T16175.1 DBLINK BioSample: SAMN00154726 KEYWORDS EST. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 365) AUTHORS Berry,R., Stevens,T.J., Walter,N.A.R., Wilcox,A.S., Rubano,T., Hopkins,J.A., Weber,J., Goold,R., Soares,M.B. and Sikela,J.M. TITLE Gene-based Sequence Tagged Sites (STSs) as the basis for a human gene map JOURNAL Nat. Genet. 10, 415-423 (1995) PUBMED 7670491 COMMENT Contact: Sikela JM Department of Pharmacology University of Colorado Health Sciences Center Box C236, 4200 E. 9th Ave, Denver CO 80262-0236 Tel: 3032708637 Fax: 3032707097 Email: nikki@tally.uchsc.edu Primers: GTTGCTTAGTGCTAGCTGGA , GCTAAAGAGCCATGAGTCCT Seq primer: -21M13 Universal. FEATURES Location/Qualifiers source 1..365 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /map="20" /map="20p13-20" /map="896D05" /clone_lib="SAMN00154726 Infant brain, Bento Soares" /lab_host="E. coli DH5-alpha" /note="Vector: BA, M13-derived; Site_1: HindIII; Site_2: NotI; The infant brain library, constructed by Bento Soares, Columbia University, was oligo-(dT) primed and directionally cloned into an M13-derived plasmid using total brain mRNA from a 72-day old human female afflicted with spinal muscular atrophy." ORIGIN 1 ccacgttgct gttgttttaa gaaaaaaaac aaaacaaaac accacagatc aagttttcta 61 acacctcagt ttcaagattg cacgtttcac atttctcagt aatttacagg cgtccacagc 121 gagatgttgc ttagtgctag ctggaggggc aagctcaggt ctagaaggga gagatgggtc 181 cgggtggagc aacacagttg ggccccaggg agtcttggag ggacccaagg aagcagaggg 241 ttttgtctcc agtcctttgg gaggggtcct ctcctcctcc aggactcatg gctctttagc 301 ctagggatgg gggaggcagg actgttggca gcaacctnan caagcctgga tatgggttcc 361 agagt //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on