Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: W27619.1
FASTA Graphics
LOCUS W27619 674 bp mRNA linear EST 08-MAY-1996 DEFINITION 35c7 Human retina cDNA randomly primed sublibrary Homo sapiens cDNA, mRNA sequence. ACCESSION W27619 VERSION W27619.1 DBLINK BioSample: SAMN00155044 KEYWORDS EST. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 674) AUTHORS Macke,J., Smallwood,P. and Nathans,J. TITLE Adult Human Retina cDNA JOURNAL Unpublished COMMENT Contact: Dr. Jeremy Nathans Dr. Jeremy Nathans, Dept. of Molecular Biology and Genetics Johns Hopkins School of Medicine 725 North Wolfe Street, Baltimore, MD 21205 Tel: 410 955 4678 Fax: 410 614 0827 Email: jeremy_nathans@qmail.bs.jhu.edu Clones from this library are NOT available. PCR PRimers FORWARD: CTTTTGAGCAAGTTCAGCCTGGTTAAGT BACKWARD: GAGGTGGCTTATGAGTATTTCTTCCAGGGTAA Seq primer: GGGTAAAAAGCAAAAGAATT. FEATURES Location/Qualifiers source 1..674 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /sex="mixed (males and females)" /tissue_type="retina" /clone_lib="SAMN00155044 Human retina cDNA randomly primed sublibrary" /dev_stage="adult" /lab_host="E. coli strain K802" /note="Organ: eye; Vector: lambda gt10; Site_1: EcoRI; Site_2: EcoRI; The library used for sequencing was a sublibrary derived from a human retina cDNA library. Inserts from retina cDNA library DNA were isolated, randomly primed, PCR amplified, size-selected, and cloned into lambda gt10. Individual plaques were arrayed and used as templates for PCR amplification, and these PCR products were used for sequencing." ORIGIN 1 tttttntnnn ttnntttcnt ttgnagctgc tgggctcatc tttacaaata ccctgcgggg 61 catattctgc actcatccca ggcgtgggga ttagagctcc atgtgcagaa cgaggggagg 121 agaggcccct ccagtgcaga agtttatctg ctatgtgttc ctgtttgggg naaattcctc 181 tagatgacgt tgataaacaa tcgtcatcct ctggcgtgac ctggatgcca acctccacgg 241 gattggatgc ttttttcatc tcgattggtg aaggggaagg tggcttatcc acagcttttt 301 ctaagcagag gctgccattg cattgtttcc gtttgtgctc gataaaaata agaatgtccc 361 ccaatgggaa gttcatctgg cactgcccac aggtgaggag gtcatgatcc cctttctgga 421 gctcccaacg ggccgggggt ttgggntcan catcttgtaa gaattggctt caaanaggct 481 cggggaaaat tcaanttggg cttancaggt tgactnaaaa nnnnnnnnnn nnnnnnnnnn 541 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 601 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnntnnnn nnnnnnnnnn nnnnnnnnnn 661 nnnnnnnnnn ntct //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on