Submitter | Handle | GNOMAD | Submitter SNP ID | coding_gnomad_14_20502872 | RefSNP(rs#) | rs1457298049 | Submitted Batch ID | coding_batch_autosomes | Submitted Date | May 17, 2017 | Publication Cited | N.D. | First entry to dbSNP | May 17 2017 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| Assay | Species | Homo sapiens | Molecular Type | Genomic | Method | GNOMAD | Ascertainment Samplesize | 30992 | Population | N.D. |
| Allele | Observed Allele | CAACAAAATAAATTCCGATA/- | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss2749088367|allelePos=26|len=51|taxid=9606|alleles='CAACAAAATAAATTCCGATA/-'|mol=Genomic GAAGATTTTG AGATTTGGAA AGTCC
N
CCACTGAATG GTTTGCTCTT TCCAT
There is no frequency submission for ss2749088367.
No sufficient data to compute Hardy-weinberg probability for ss2749088367.
There is no individual genotype data for ss2749088367.
|