Submitter | Handle | EVA_DECODE | Submitter SNP ID | deCODE2_14626 | RefSNP(rs#) | clustering in process | Submitted Batch ID | DECODE2 | Submitted Date | Sep 12, 2018 | Publication Cited | N.D. | First entry to dbSNP | Sep 12 2018 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| | Allele | Observed Allele | CCGCTGCCCCTCACCGCCGCTGCCCCTCACCG/- | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss3686004870|allelePos=26|len=51|taxid=9606|alleles='CCGCTGCCCCTCACCGCCGCTGCCCCTCACCG/-'|mol=Genomic CCCAGAGCAG TGCCTCAGGC CCGCA
N
CCGCTGCCCC TCACCACTGC TGCCC
There is no frequency submission for ss3686004870.
No sufficient data to compute Hardy-weinberg probability for ss3686004870.
There is no individual genotype data for ss3686004870.
|