NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP history

This subsnp was deleted.

Delete record
Delete Date:Feb 16, 2024
Delete Reason:HVARC-2957 & HVARC-2998
Original HandleTOMMO_GENOMICS
Orignial Submitter snp id 15:23440839_CCACATCTTCCTGCTCCCGCATCTTCTCCTGCCG_C

For the same handle and submitter snp id, the new subsnp_id is:

ss8768769508

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement