NCBI
 dbSNP
dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:1000GENOMES
Submitter Batch ID:YRI_low_coverage_pilot_indel
Submitter Method ID:LOW_COVERAGE_PILOT_INDELS
Citation:A map of human genome variation from population-scale sequencing.SNP detection and genotyping from low coverage sequencing data on multiple diploid samples.Dindel: Accurate indel calls from short-read data.
Population:pilot_1_YRI_low_coverage_panel
Comment:not supplied
Batch Total SubSNP(ss) Count:941567


SubSNP(ss) Submitter
SNP_ID		 SNP
Allele		 Samplesize RefSNP(rs) ss2rs
Orien		 Chr ChrPos Contig
Accession		 Contig
Pos
ss325997302 YRI_chr1_994252_indel -/C 118 rs138373747 0 1 1069009 NT_032977.10 483021
ss325997305 YRI_chr1_996376_indel -/A 118 rs137970846 0 1 1071133 NT_032977.10 485145
ss325997306 YRI_chr1_999588_indel -/GGTCATGCT 118 rs143529814 0 1 1074345 NT_032977.10 488357
ss325997308 YRI_chr1_1000950_indel -/G 118 rs60561655 0 1 1075708 NT_032977.10 489720
ss325997310 YRI_chr1_1006395_indel -/G 118 rs113519695 0 1 1081152 NT_032977.10 495164
ss325997312 YRI_chr1_1006887_indel -/G 118 rs113385670 0 1 1081644 NT_032977.10 495656
ss325997314 YRI_chr1_1010745_indel -/A 118 rs139568537 0 1 1085503 NT_032977.10 499515
ss325997315 YRI_chr1_1010786_indel -/G 118 rs70949550 0 1 1085543 NT_032977.10 499555
ss325997317 YRI_chr1_1025357_indel -/GACG 118 rs149094393 0 1 1100115 NT_032977.10 514127
ss325997319 YRI_chr1_1026158_indel -/GGGGG 118 rs143916981 0 1 1100915 NT_032977.10 514927
ss325997320 YRI_chr1_1026730_indel -/AT 118 rs141449834 0 1 1101488 NT_032977.10 515500
ss325997323 YRI_chr1_1028860_indel -/CTC 118 rs71576598 0 1 1103618 NT_032977.10 517630
ss325997324 YRI_chr1_1029236_indel -/T 118 rs34796184 1 1 1103993 NT_032977.10 518005
ss325997326 YRI_chr1_1029695_indel -/T 118 rs149608175 0 1 1104453 NT_032977.10 518465
ss325997328 YRI_chr1_1031889_indel -/CA 118 rs112018535 0 1 1106647 NT_032977.10 520659
ss325997329 YRI_chr1_1034351_indel -/CCACAGCCAAAAGGTGGGAGCAAGTGTCCAC 118 rs142246657 0 1 1109109 NT_032977.10 523121
ss325997332 YRI_chr1_1040020_indel -/C 118 rs142862168 0 1 1114778 NT_032977.10 528790
ss325997334 YRI_chr1_1040409_indel -/T 118 rs111382468 0 1 1115167 NT_032977.10 529179
ss325997336 YRI_chr1_1040517_indel -/A 118 rs74912773 0 1 1115274 NT_032977.10 529286
ss325997338 YRI_chr1_1043690_indel -/G 118 rs5772037 0 1 1118447 NT_032977.10 532459
ss325997340 YRI_chr1_1044714_indel -/C 118 rs141991501 0 1 1119471 NT_032977.10 533483
ss325997342 YRI_chr1_1046155_indel -/AAAA 118 rs151161169 0 1 1120913 NT_032977.10 534925
ss325997344 YRI_chr1_1048343_indel -/CGCAGGGT 118 rs150232421 0 1 1123100 NT_032977.10 537112
ss325997347 YRI_chr1_1048705_indel -/C 118 rs145913629 0 1 1123462 NT_032977.10 537474
ss325997349 YRI_chr1_1048742_indel -/CACCTGCACG 118 rs149555176 0 1 1123500 NT_032977.10 537512
ss325997351 YRI_chr1_1050369_indel -/C 118 rs148731474 0 1 1125127 NT_032977.10 539139
ss325997353 YRI_chr1_1051192_indel -/A 118 rs147402771 0 1 1125956 NT_032977.10 539968
ss325997354 YRI_chr1_1052327_indel -/TACCTGAA 118 rs139701761 0 1 1127084 NT_032977.10 541096
ss325997356 YRI_chr1_1055459_indel -/C 118 rs139209855 0 1 1130217 NT_032977.10 544229
ss325997358 YRI_chr1_1056251_indel -/T 118 rs34287831 1 1 1131008 NT_032977.10 545020
30 of 941567 subsnp's starting at ss325997302. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement