Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: ADF69698.1
Identical Proteins FASTA Graphics
LOCUS ADF69698 219 aa linear INV 17-FEB-2012 DEFINITION cytochrome oxidase subunit 1, partial (mitochondrion) [Tinea columbariella]. ACCESSION ADF69698 VERSION ADF69698.1 DBLINK BioProject: PRJNA37833 DBSOURCE accession GU695981.1 KEYWORDS . SOURCE mitochondrion Tinea columbariella ORGANISM Tinea columbariella Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata; Ditrysia; Tineoidea; Tineidae; Tineinae; Tinea. REFERENCE 1 (residues 1 to 219) CONSRTM International Barcode of Life (iBOL) TITLE iBOL Data Release JOURNAL Unpublished REFERENCE 2 (residues 1 to 219) CONSRTM International Barcode of Life (iBOL) TITLE Direct Submission JOURNAL Submitted (04-FEB-2010) Biodiversity Institute of Ontario, University of Guelph, 50 Stone Rd West, Guelph, Ontario N1G2W1, Canada COMMENT Method: conceptual translation. FEATURES Location/Qualifiers source 1..219 /organism="Tinea columbariella" /organelle="mitochondrion" /specimen_voucher="EN-91-0006" /db_xref="BOLD:LTOL067-06.COI-5P" /db_xref="taxon:655052" /geo_loc_name="Australia: Tasmania" /lat_lon="42.88 S 147.32 E" /collection_date="01-Jan-1991" /collected_by="Ebbe S. Nielsen" /PCR_primers="fwd_seq: attcaaccaatcataaagatattgg, rev_seq: taaacttctggatgtccaaaaaatca" Protein <1..>219 /product="cytochrome oxidase subunit 1" Region 1..>219 /region_name="Heme_Cu_Oxidase_I" /note="Heme-copper oxidase subunit I. Heme-copper oxidases are transmembrane protein complexes in the respiratory chains of prokaryotes and mitochondria which catalyze the reduction of O2 and simultaneously pump protons across the membrane. The superfamily is...; cl00275" /db_xref="CDD:469701" Site order(3,64,75,82,85,140..141,147,151) /site_type="active" /note="D-pathway [active]" /db_xref="CDD:238461" CDS 1..219 /gene="COI" /coded_by="GU695981.1:<1..>658" /codon_start=2 /transl_table=5 ORIGIN 1 tlyfifgiws gmmgtslsll irtelgnpgl ligddqiynt ivtahafimi ffmvmpimig 61 gfgnwlvplm lgapdmafpr lnnmsfwllp pslllltssg ivengagtgw tvypplssti 121 ahsggsvdla ifslhlagis silgainfit tvinmrpmgm sfdqmplfvw avvitailll 181 lslpvlagai tmlltdrnln tsffdpaggg dpilyqhlf //
Whole sequence Selected region from: to:
Conserved Domains
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on