U.S. flag

An official website of the United States government

cytochrome oxidase subunit 1, partial (mitochondrion) [Tinea columbariella]

GenBank: ADF69698.1

Identical Proteins FASTA Graphics 

LOCUS       ADF69698                 219 aa            linear   INV 17-FEB-2012
DEFINITION  cytochrome oxidase subunit 1, partial (mitochondrion) [Tinea
            columbariella].
ACCESSION   ADF69698
VERSION     ADF69698.1
DBLINK      BioProject: PRJNA37833
DBSOURCE    accession GU695981.1
KEYWORDS    .
SOURCE      mitochondrion Tinea columbariella
  ORGANISM  Tinea columbariella
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata;
            Ditrysia; Tineoidea; Tineidae; Tineinae; Tinea.
REFERENCE   1  (residues 1 to 219)
  CONSRTM   International Barcode of Life (iBOL)
  TITLE     iBOL Data Release
  JOURNAL   Unpublished
REFERENCE   2  (residues 1 to 219)
  CONSRTM   International Barcode of Life (iBOL)
  TITLE     Direct Submission
  JOURNAL   Submitted (04-FEB-2010) Biodiversity Institute of Ontario,
            University of Guelph, 50 Stone Rd West, Guelph, Ontario N1G2W1,
            Canada
COMMENT     Method: conceptual translation.
FEATURES             Location/Qualifiers
     source          1..219
                     /organism="Tinea columbariella"
                     /organelle="mitochondrion"
                     /specimen_voucher="EN-91-0006"
                     /db_xref="BOLD:LTOL067-06.COI-5P"
                     /db_xref="taxon:655052"
                     /geo_loc_name="Australia: Tasmania"
                     /lat_lon="42.88 S 147.32 E"
                     /collection_date="01-Jan-1991"
                     /collected_by="Ebbe S. Nielsen"
                     /PCR_primers="fwd_seq: attcaaccaatcataaagatattgg, rev_seq:
                     taaacttctggatgtccaaaaaatca"
     Protein         <1..>219
                     /product="cytochrome oxidase subunit 1"
     Region          1..>219
                     /region_name="Heme_Cu_Oxidase_I"
                     /note="Heme-copper oxidase subunit I. Heme-copper oxidases
                     are transmembrane protein complexes in the respiratory
                     chains of prokaryotes and mitochondria which catalyze the
                     reduction of O2 and simultaneously pump protons across the
                     membrane. The superfamily is...; cl00275"
                     /db_xref="CDD:469701"
     Site            order(3,64,75,82,85,140..141,147,151)
                     /site_type="active"
                     /note="D-pathway [active]"
                     /db_xref="CDD:238461"
     CDS             1..219
                     /gene="COI"
                     /coded_by="GU695981.1:<1..>658"
                     /codon_start=2
                     /transl_table=5
ORIGIN      
        1 tlyfifgiws gmmgtslsll irtelgnpgl ligddqiynt ivtahafimi ffmvmpimig
       61 gfgnwlvplm lgapdmafpr lnnmsfwllp pslllltssg ivengagtgw tvypplssti
      121 ahsggsvdla ifslhlagis silgainfit tvinmrpmgm sfdqmplfvw avvitailll
      181 lslpvlagai tmlltdrnln tsffdpaggg dpilyqhlf
//
Feature
Display: FASTA GenBank Help
Details

Supplemental Content

Change region shown

Customize view

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
External link. Please review our privacy policy.