Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: AEY79357.1
Identical Proteins FASTA Graphics
LOCUS AEY79357 138 aa linear BCT 29-JAN-2012 DEFINITION chaperonin-like protein [Anabaenopsis circularis NIES-21]. ACCESSION AEY79357 VERSION AEY79357.1 DBSOURCE accession JN251747.1 KEYWORDS . SOURCE Anabaenopsis circularis NIES-21 ORGANISM Anabaenopsis circularis NIES-21 Bacteria; Bacillati; Cyanobacteriota; Cyanophyceae; Nostocales; Aphanizomenonaceae; Anabaenopsis. REFERENCE 1 (residues 1 to 138) AUTHORS Hong,J.W. and Yoon,H.-S. TITLE Isolation and characterization of an alkane-producing cyanobacterium Nostoc sp. KNUA003 from Lake Daecheong, South Korea JOURNAL Unpublished REFERENCE 2 (residues 1 to 138) AUTHORS Hong,J.W. and Yoon,H.-S. TITLE Direct Submission JOURNAL Submitted (13-JUL-2011) Department of Biology, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701, South Korea FEATURES Location/Qualifiers source 1..138 /organism="Anabaenopsis circularis NIES-21" /strain="NIES-21" /culture_collection="NIES:21" /db_xref="taxon:1085406" /geo_loc_name="Japan" /PCR_primers="fwd_name: cw, fwd_seq: cgtagcttccggtggtatccacgt, rev_name: cx, rev_seq: ggggcaggtaagaaagggtttcgta" Protein 1..138 /product="chaperonin-like protein" /name="rbcX" Region 16..114 /region_name="RbcX" /note="RbcX protein; pfam02341" /db_xref="CDD:426729" CDS 1..138 /gene="rbcX" /coded_by="JN251747.1:383..799" /transl_table=11 ORIGIN 1 mwagssmnlk qiakdtaktl qsyltyqalm tvlaqlgetn pplalwlqtf sagkvqdgea 61 yikqlfrekp dlalrimtvr ehiaeeiadf lpemvrsgiq qgnmeqrrqh lermtqlsls 121 dpspeseqqt isepdwdh //
Whole sequence Selected region from: to:
Conserved Domains
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on