Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1490608809

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr1:186912732-186912740 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delTATA / delTA / insAGTATAC(AT)5A…

delTATA / delTA / insAGTATAC(AT)5ACTTATG(TA)5 / dupTA / dup(TA)3

Variation Type
Indel Insertion and Deletion
Frequency
dupTA=0.000008 (2/264690, TOPMED)
dup(TA)3=0.000008 (1/126922, GnomAD)
delTATA=0.00000 (0/11856, ALFA) (+ 2 more)
delTA=0.00000 (0/11856, ALFA)
dupTA=0.00000 (0/11856, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
PLA2G4A : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 11856 ATATATATA=1.00000 ATATA=0.00000, ATATATA=0.00000, ATATATATATA=0.00000 1.0 0.0 0.0 N/A
European Sub 7616 ATATATATA=1.0000 ATATA=0.0000, ATATATA=0.0000, ATATATATATA=0.0000 1.0 0.0 0.0 N/A
African Sub 2814 ATATATATA=1.0000 ATATA=0.0000, ATATATA=0.0000, ATATATATATA=0.0000 1.0 0.0 0.0 N/A
African Others Sub 108 ATATATATA=1.000 ATATA=0.000, ATATATA=0.000, ATATATATATA=0.000 1.0 0.0 0.0 N/A
African American Sub 2706 ATATATATA=1.0000 ATATA=0.0000, ATATATA=0.0000, ATATATATATA=0.0000 1.0 0.0 0.0 N/A
Asian Sub 108 ATATATATA=1.000 ATATA=0.000, ATATATA=0.000, ATATATATATA=0.000 1.0 0.0 0.0 N/A
East Asian Sub 84 ATATATATA=1.00 ATATA=0.00, ATATATA=0.00, ATATATATATA=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 24 ATATATATA=1.00 ATATA=0.00, ATATATA=0.00, ATATATATATA=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 146 ATATATATA=1.000 ATATA=0.000, ATATATA=0.000, ATATATATATA=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 610 ATATATATA=1.000 ATATA=0.000, ATATATA=0.000, ATATATATATA=0.000 1.0 0.0 0.0 N/A
South Asian Sub 94 ATATATATA=1.00 ATATA=0.00, ATATATA=0.00, ATATATATATA=0.00 1.0 0.0 0.0 N/A
Other Sub 468 ATATATATA=1.000 ATATA=0.000, ATATATA=0.000, ATATATATATA=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 -

No frequency provided

dupTA=0.000008
gnomAD - Genomes Global Study-wide 126922 -

No frequency provided

dup(TA)3=0.000008
gnomAD - Genomes European Sub 70650 -

No frequency provided

dup(TA)3=0.00000
gnomAD - Genomes African Sub 35886 -

No frequency provided

dup(TA)3=0.00003
gnomAD - Genomes American Sub 12156 -

No frequency provided

dup(TA)3=0.00000
gnomAD - Genomes Ashkenazi Jewish Sub 3244 -

No frequency provided

dup(TA)3=0.0000
gnomAD - Genomes East Asian Sub 3074 -

No frequency provided

dup(TA)3=0.0000
gnomAD - Genomes Other Sub 1912 -

No frequency provided

dup(TA)3=0.0000
Allele Frequency Aggregator Total Global 11856 (AT)4A=1.00000 delTATA=0.00000, delTA=0.00000, dupTA=0.00000
Allele Frequency Aggregator European Sub 7616 (AT)4A=1.0000 delTATA=0.0000, delTA=0.0000, dupTA=0.0000
Allele Frequency Aggregator African Sub 2814 (AT)4A=1.0000 delTATA=0.0000, delTA=0.0000, dupTA=0.0000
Allele Frequency Aggregator Latin American 2 Sub 610 (AT)4A=1.000 delTATA=0.000, delTA=0.000, dupTA=0.000
Allele Frequency Aggregator Other Sub 468 (AT)4A=1.000 delTATA=0.000, delTA=0.000, dupTA=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 (AT)4A=1.000 delTATA=0.000, delTA=0.000, dupTA=0.000
Allele Frequency Aggregator Asian Sub 108 (AT)4A=1.000 delTATA=0.000, delTA=0.000, dupTA=0.000
Allele Frequency Aggregator South Asian Sub 94 (AT)4A=1.00 delTATA=0.00, delTA=0.00, dupTA=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 1 NC_000001.11:g.186912733TA[2]
GRCh38.p14 chr 1 NC_000001.11:g.186912733TA[3]
GRCh38.p14 chr 1 NC_000001.11:g.186912732_186912740AT[4]AAGTATACATATATATATACTTATGTATATATATA[1]
GRCh38.p14 chr 1 NC_000001.11:g.186912733TA[5]
GRCh38.p14 chr 1 NC_000001.11:g.186912733TA[7]
GRCh37.p13 chr 1 NC_000001.10:g.186881865TA[2]
GRCh37.p13 chr 1 NC_000001.10:g.186881865TA[3]
GRCh37.p13 chr 1 NC_000001.10:g.186881864_186881872AT[4]AAGTATACATATATATATACTTATGTATATATATA[1]
GRCh37.p13 chr 1 NC_000001.10:g.186881865TA[5]
GRCh37.p13 chr 1 NC_000001.10:g.186881865TA[7]
PLA2G4A RefSeqGene (LRG_596) NG_012203.2:g.88834TA[2]
PLA2G4A RefSeqGene (LRG_596) NG_012203.2:g.88834TA[3]
PLA2G4A RefSeqGene (LRG_596) NG_012203.2:g.88833_88841AT[4]AAGTATACATATATATATACTTATGTATATATATA[1]
PLA2G4A RefSeqGene (LRG_596) NG_012203.2:g.88834TA[5]
PLA2G4A RefSeqGene (LRG_596) NG_012203.2:g.88834TA[7]
Gene: PLA2G4A, phospholipase A2 group IVA (plus strand)
Molecule type Change Amino acid[Codon] SO Term
PLA2G4A transcript variant 2 NM_001311193.2:c.378+1852…

NM_001311193.2:c.378+18521AT[2]

N/A Intron Variant
PLA2G4A transcript variant 1 NM_024420.3:c.558+1343AT[…

NM_024420.3:c.558+1343AT[2]

N/A Intron Variant
PLA2G4A transcript variant X1 XM_005245267.5:c.573+1343…

XM_005245267.5:c.573+1343AT[2]

N/A Intron Variant
PLA2G4A transcript variant X2 XM_011509642.3:c.558+1343…

XM_011509642.3:c.558+1343AT[2]

N/A Intron Variant
PLA2G4A transcript variant X3 XM_047422599.1:c.558+1343…

XM_047422599.1:c.558+1343AT[2]

N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement (AT)4A= delTATA delTA insAGTATAC(AT)5ACTTATG(TA)5 dupTA dup(TA)3
GRCh38.p14 chr 1 NC_000001.11:g.186912732_186912740= NC_000001.11:g.186912733TA[2] NC_000001.11:g.186912733TA[3] NC_000001.11:g.186912732_186912740AT[4]AAGTATACATATATATATACTTATGTATATATATA[1] NC_000001.11:g.186912733TA[5] NC_000001.11:g.186912733TA[7]
GRCh37.p13 chr 1 NC_000001.10:g.186881864_186881872= NC_000001.10:g.186881865TA[2] NC_000001.10:g.186881865TA[3] NC_000001.10:g.186881864_186881872AT[4]AAGTATACATATATATATACTTATGTATATATATA[1] NC_000001.10:g.186881865TA[5] NC_000001.10:g.186881865TA[7]
PLA2G4A RefSeqGene (LRG_596) NG_012203.2:g.88833_88841= NG_012203.2:g.88834TA[2] NG_012203.2:g.88834TA[3] NG_012203.2:g.88833_88841AT[4]AAGTATACATATATATATACTTATGTATATATATA[1] NG_012203.2:g.88834TA[5] NG_012203.2:g.88834TA[7]
PLA2G4A transcript variant 2 NM_001311193.2:c.378+18521= NM_001311193.2:c.378+18521AT[2] NM_001311193.2:c.378+18521AT[3] NM_001311193.2:c.378+18529_378+18530insAGTATACATATATATATACTTATGTATATATATA NM_001311193.2:c.378+18521AT[5] NM_001311193.2:c.378+18521AT[7]
PLA2G4A transcript variant 1 NM_024420.2:c.558+1343= NM_024420.2:c.558+1343AT[2] NM_024420.2:c.558+1343AT[3] NM_024420.2:c.558+1351_558+1352insAGTATACATATATATATACTTATGTATATATATA NM_024420.2:c.558+1343AT[5] NM_024420.2:c.558+1343AT[7]
PLA2G4A transcript variant 1 NM_024420.3:c.558+1343= NM_024420.3:c.558+1343AT[2] NM_024420.3:c.558+1343AT[3] NM_024420.3:c.558+1351_558+1352insAGTATACATATATATATACTTATGTATATATATA NM_024420.3:c.558+1343AT[5] NM_024420.3:c.558+1343AT[7]
PLA2G4A transcript variant X1 XM_005245267.1:c.447+1343= XM_005245267.1:c.447+1343AT[2] XM_005245267.1:c.447+1343AT[3] XM_005245267.1:c.447+1351_447+1352insAGTATACATATATATATACTTATGTATATATATA XM_005245267.1:c.447+1343AT[5] XM_005245267.1:c.447+1343AT[7]
PLA2G4A transcript variant X1 XM_005245267.5:c.573+1343= XM_005245267.5:c.573+1343AT[2] XM_005245267.5:c.573+1343AT[3] XM_005245267.5:c.573+1351_573+1352insAGTATACATATATATATACTTATGTATATATATA XM_005245267.5:c.573+1343AT[5] XM_005245267.5:c.573+1343AT[7]
PLA2G4A transcript variant X2 XM_005245268.1:c.378+18521= XM_005245268.1:c.378+18521AT[2] XM_005245268.1:c.378+18521AT[3] XM_005245268.1:c.378+18529_378+18530insAGTATACATATATATATACTTATGTATATATATA XM_005245268.1:c.378+18521AT[5] XM_005245268.1:c.378+18521AT[7]
PLA2G4A transcript variant X2 XM_011509642.3:c.558+1343= XM_011509642.3:c.558+1343AT[2] XM_011509642.3:c.558+1343AT[3] XM_011509642.3:c.558+1351_558+1352insAGTATACATATATATATACTTATGTATATATATA XM_011509642.3:c.558+1343AT[5] XM_011509642.3:c.558+1343AT[7]
PLA2G4A transcript variant X3 XM_047422599.1:c.558+1343= XM_047422599.1:c.558+1343AT[2] XM_047422599.1:c.558+1343AT[3] XM_047422599.1:c.558+1351_558+1352insAGTATACATATATATATACTTATGTATATATATA XM_047422599.1:c.558+1343AT[5] XM_047422599.1:c.558+1343AT[7]
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

7 SubSNP, 7 Frequency submissions
No Submitter Submission ID Date (Build)
1 EVA_DECODE ss3688214529 Jul 12, 2019 (153)
2 GNOMAD ss4007586673 Apr 25, 2021 (155)
3 TOPMED ss4476178981 Apr 25, 2021 (155)
4 TOMMO_GENOMICS ss5147485975 Apr 25, 2021 (155)
5 TOMMO_GENOMICS ss5147485976 Apr 25, 2021 (155)
6 TOMMO_GENOMICS ss5674974301 Oct 12, 2022 (156)
7 TOMMO_GENOMICS ss5674974302 Oct 12, 2022 (156)
8 gnomAD - Genomes NC_000001.11 - 186912732 Apr 25, 2021 (155)
9 8.3KJPN

Submission ignored due to conflicting rows:
Row 5455282 (NC_000001.10:186881863::ATATATATAAGTATACATATATATATACTTATGT 21/16760)
Row 5455283 (NC_000001.10:186881863::AT 1/16760)

- Apr 25, 2021 (155)
10 8.3KJPN

Submission ignored due to conflicting rows:
Row 5455282 (NC_000001.10:186881863::ATATATATAAGTATACATATATATATACTTATGT 21/16760)
Row 5455283 (NC_000001.10:186881863::AT 1/16760)

- Apr 25, 2021 (155)
11 14KJPN

Submission ignored due to conflicting rows:
Row 8811405 (NC_000001.11:186912731::ATATATATAAGTATACATATATATATACTTATGT 29/28256)
Row 8811406 (NC_000001.11:186912731::AT 2/28256)

- Oct 12, 2022 (156)
12 14KJPN

Submission ignored due to conflicting rows:
Row 8811405 (NC_000001.11:186912731::ATATATATAAGTATACATATATATATACTTATGT 29/28256)
Row 8811406 (NC_000001.11:186912731::AT 2/28256)

- Oct 12, 2022 (156)
13 TopMed NC_000001.11 - 186912732 Apr 25, 2021 (155)
14 ALFA NC_000001.11 - 186912732 Apr 25, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
9545698011 NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATA

NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATA

(self)
ss3688214529 NC_000001.11:186912731:AT: NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATA

(self)
9545698011 NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATA

NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATA

(self)
ss5147485975 NC_000001.10:186881863::ATATATATAA…

NC_000001.10:186881863::ATATATATAAGTATACATATATATATACTTATGT

NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATAAGTATACATATATATATACTTATGTATATATATA

(self)
ss5674974301 NC_000001.11:186912731::ATATATATAA…

NC_000001.11:186912731::ATATATATAAGTATACATATATATATACTTATGT

NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATAAGTATACATATATATATACTTATGTATATATATA

ss5147485976 NC_000001.10:186881863::AT NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATATA

(self)
39785316, ss4476178981, ss5674974302 NC_000001.11:186912731::AT NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATATA

(self)
9545698011 NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATATA

NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATATA

(self)
33483017, ss4007586673 NC_000001.11:186912731::ATATAT NC_000001.11:186912731:ATATATATA:A…

NC_000001.11:186912731:ATATATATA:ATATATATATATATA

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1490608809

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d