Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1491135115

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr9:86011913-86011949 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
dupTATC(ATATA)2TAC(TATAATA)2TA
Variation Type
Indel Insertion and Deletion
Frequency
dupTATC(ATATA)2TAC(TATAATA)2TA=0.004278 (551/128790, GnomAD)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
NAA35 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
gnomAD - Genomes Global Study-wide 128790 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.004278
gnomAD - Genomes European Sub 70284 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.00004
gnomAD - Genomes African Sub 38458 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.01386
gnomAD - Genomes American Sub 11756 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.00068
gnomAD - Genomes Ashkenazi Jewish Sub 3260 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.0000
gnomAD - Genomes East Asian Sub 3096 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.0000
gnomAD - Genomes Other Sub 1936 -

No frequency provided

dupTATC(ATATA)2TAC(TATAATA)2TA=0.0036
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 9 NC_000009.12:g.86011917_86011949dup
GRCh37.p13 chr 9 NC_000009.11:g.88626832_88626864dup
Gene: NAA35, N-alpha-acetyltransferase 35, NatC auxiliary subunit (plus strand)
Molecule type Change Amino acid[Codon] SO Term
NAA35 transcript variant 2 NM_001321881.2:c.1291-112…

NM_001321881.2:c.1291-1129_1291-1097dup

N/A Intron Variant
NAA35 transcript variant 3 NM_001321882.2:c.1291-112…

NM_001321882.2:c.1291-1129_1291-1097dup

N/A Intron Variant
NAA35 transcript variant 1 NM_024635.4:c.1291-1129_1…

NM_024635.4:c.1291-1129_1291-1097dup

N/A Intron Variant
NAA35 transcript variant X1 XM_005252127.5:c.1291-112…

XM_005252127.5:c.1291-1129_1291-1097dup

N/A Intron Variant
NAA35 transcript variant X3 XM_024447648.2:c.631-1129…

XM_024447648.2:c.631-1129_631-1097dup

N/A Intron Variant
NAA35 transcript variant X4 XM_024447649.2:c.499-1129…

XM_024447649.2:c.499-1129_499-1097dup

N/A Intron Variant
NAA35 transcript variant X2 XM_047423710.1:c.823-1129…

XM_047423710.1:c.823-1129_823-1097dup

N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement (TA)3TC(ATATA)2TAC(TATAATA)2TA= dupTATC(ATATA)2TAC(TATAATA)2TA
GRCh38.p14 chr 9 NC_000009.12:g.86011913_86011949= NC_000009.12:g.86011917_86011949dup
GRCh37.p13 chr 9 NC_000009.11:g.88626828_88626864= NC_000009.11:g.88626832_88626864dup
NAA35 transcript variant 2 NM_001321881.2:c.1291-1133= NM_001321881.2:c.1291-1129_1291-1097dup
NAA35 transcript variant 3 NM_001321882.2:c.1291-1133= NM_001321882.2:c.1291-1129_1291-1097dup
NAA35 transcript variant 1 NM_024635.3:c.1291-1133= NM_024635.3:c.1291-1129_1291-1097dup
NAA35 transcript variant 1 NM_024635.4:c.1291-1133= NM_024635.4:c.1291-1129_1291-1097dup
NAA35 transcript variant X1 XM_005252125.1:c.1414-1133= XM_005252125.1:c.1414-1129_1414-1097dup
NAA35 transcript variant X2 XM_005252126.1:c.1291-1133= XM_005252126.1:c.1291-1129_1291-1097dup
NAA35 transcript variant X3 XM_005252127.1:c.1291-1133= XM_005252127.1:c.1291-1129_1291-1097dup
NAA35 transcript variant X1 XM_005252127.5:c.1291-1133= XM_005252127.5:c.1291-1129_1291-1097dup
NAA35 transcript variant X4 XM_005252128.1:c.823-1133= XM_005252128.1:c.823-1129_823-1097dup
NAA35 transcript variant X3 XM_024447648.2:c.631-1133= XM_024447648.2:c.631-1129_631-1097dup
NAA35 transcript variant X4 XM_024447649.2:c.499-1133= XM_024447649.2:c.499-1129_499-1097dup
NAA35 transcript variant X2 XM_047423710.1:c.823-1133= XM_047423710.1:c.823-1129_823-1097dup
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

3 SubSNP, 1 Frequency submissions
No Submitter Submission ID Date (Build)
1 GNOMAD ss2880199892 Jan 10, 2018 (151)
2 1000G_HIGH_COVERAGE ss5281244060 Oct 13, 2022 (156)
3 HUGCELL_USP ss5477208708 Oct 13, 2022 (156)
4 gnomAD - Genomes NC_000009.12 - 86011913 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss2880199892 NC_000009.11:88626827::TATATATCATA…

NC_000009.11:88626827::TATATATCATATAATATATACTATAATATATAA

NC_000009.12:86011912:TATATATCATAT…

NC_000009.12:86011912:TATATATCATATAATATATACTATAATATATAATATA:TATATATCATATAATATATACTATAATATATAATATATATCATATAATATATACTATAATATATAATATA

(self)
329976318, ss5281244060, ss5477208708 NC_000009.12:86011912::TATATATCATA…

NC_000009.12:86011912::TATATATCATATAATATATACTATAATATATAA

NC_000009.12:86011912:TATATATCATAT…

NC_000009.12:86011912:TATATATCATATAATATATACTATAATATATAATATA:TATATATCATATAATATATACTATAATATATAATATATATCATATAATATATACTATAATATATAATATA

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1491135115

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d