SNP Links for Nucleotide (Select 1189398331) - SNP

Links from Nucleotide

Items: 1 to 20 of 813

<< First< Prev

Page of 41

Next >Last >>

Select item 14901966221.

rs1490196622 [Homo sapiens]

Variant type:: SNV
Alleles:: A>G [Show Flanks]
Chromosome:: 17:16924074 (GRCh38)
17:16827388 (GRCh37)
Canonical SPDI:: NC_000017.11:16924073:A:G
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: G=0./0 (ALFA)
G=0.000015/4 (TOPMED)
HGVS:: NC_000017.11:g.16924074A>G, NC_000017.10:g.16827388A>G, NR_147084.1:n.2123T>C

Select item 14894851582.

rs1489485158 [Homo sapiens]

Variant type:: SNV
Alleles:: C>A,T [Show Flanks]
Chromosome:: 17:16929584 (GRCh38)
17:16832898 (GRCh37)
Canonical SPDI:: NC_000017.11:16929583:C:A,NC_000017.11:16929583:C:T
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.000004/1 (TOPMED)
HGVS:: NC_000017.11:g.16929584C>A, NC_000017.11:g.16929584C>T, NC_000017.10:g.16832898C>A, NC_000017.10:g.16832898C>T, NR_147084.1:n.936G>T, NR_147084.1:n.936G>A

Select item 14890020303.

rs1489002030 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16923570 (GRCh38)
17:16826884 (GRCh37)
Canonical SPDI:: NC_000017.11:16923569:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: A=0./0 (ALFA)
A=0.000014/2 (GnomAD)
A=0.000015/4 (TOPMED)
HGVS:: NC_000017.11:g.16923570G>A, NC_000017.10:g.16826884G>A, NR_147084.1:n.2627C>T

Select item 14877030244.

rs1487703024 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 17:16930350 (GRCh38)
17:16833664 (GRCh37)
Canonical SPDI:: NC_000017.11:16930349:C:T
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.000011/3 (TOPMED)
T=0.000014/2 (GnomAD)
T=0.000071/1 (TOMMO)
HGVS:: NC_000017.11:g.16930350C>T, NC_000017.10:g.16833664C>T, NR_147084.1:n.485G>A

Select item 14874732065.

rs1487473206 has merged into rs1194497359 [Homo sapiens]

Variant type:: DELINS
Alleles:: CTGGCTGGCTGG>-,CTGGCTGG,CTGGCTGGCTGGCTGG,CTGGCTGGCTGGCTGGCTGG [Show Flanks]
Chromosome:: 17:16923636 (GRCh38)
17:16826950 (GRCh37)
Canonical SPDI:: NC_000017.11:16923626:GCTGGCTGGCTGGCTGGCTGG:GCTGGCTGG,NC_000017.11:16923626:GCTGGCTGGCTGGCTGGCTGG:GCTGGCTGGCTGGCTGG,NC_000017.11:16923626:GCTGGCTGGCTGGCTGGCTGG:GCTGGCTGGCTGGCTGGCTGGCTGG,NC_000017.11:16923626:GCTGGCTGGCTGGCTGGCTGG:GCTGGCTGGCTGGCTGGCTGGCTGGCTGG
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: GCTGGCTGGCTGGCTGG=0./0 (ALFA)
HGVS:: NC_000017.11:g.16923628CTGG[2], NC_000017.11:g.16923628CTGG[4], NC_000017.11:g.16923628CTGG[6], NC_000017.11:g.16923628CTGG[7], NC_000017.10:g.16826942CTGG[2], NC_000017.10:g.16826942CTGG[4], NC_000017.10:g.16826942CTGG[6], NC_000017.10:g.16826942CTGG[7], NR_147084.1:n.2551CAGC[2], NR_147084.1:n.2551CAGC[4], NR_147084.1:n.2551CAGC[6], NR_147084.1:n.2551CAGC[7]

Select item 14871260056.

rs1487126005 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 17:16929672 (GRCh38)
17:16832986 (GRCh37)
Canonical SPDI:: NC_000017.11:16929671:C:T
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.000004/1 (TOPMED)
T=0.000021/3 (GnomAD)
T=0.00006/1 (TOMMO)
HGVS:: NC_000017.11:g.16929672C>T, NC_000017.10:g.16832986C>T, NR_147084.1:n.848G>A

Select item 14869417077.

rs1486941707 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16932214 (GRCh38)
17:16835528 (GRCh37)
Canonical SPDI:: NC_000017.11:16932213:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: A=0.000071/1 (ALFA)
A=0.000023/6 (TOPMED)
HGVS:: NC_000017.11:g.16932214G>A, NC_000017.10:g.16835528G>A, NR_147084.1:n.383C>T

Select item 14847842618.

rs1484784261 [Homo sapiens]

Variant type:: SNV
Alleles:: T>G [Show Flanks]
Chromosome:: 17:16933069 (GRCh38)
17:16836383 (GRCh37)
Canonical SPDI:: NC_000017.11:16933068:T:G
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: G=0./0 (ALFA)
G=0.000007/1 (GnomAD)
G=0.000008/2 (TOPMED)
G=0.000011/1 (GnomAD_exomes)
HGVS:: NC_000017.11:g.16933069T>G, NC_000017.10:g.16836383T>G, NR_147084.1:n.108A>C

Select item 14843155339.

rs1484315533 [Homo sapiens]

Variant type:: SNV
Alleles:: T>C [Show Flanks]
Chromosome:: 17:16923390 (GRCh38)
17:16826704 (GRCh37)
Canonical SPDI:: NC_000017.11:16923389:T:C
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: C=0./0 (ALFA)
HGVS:: NC_000017.11:g.16923390T>C, NC_000017.10:g.16826704T>C, NR_147084.1:n.2807A>G

Select item 148330206810.

rs1483302068 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16933163 (GRCh38)
17:16836477 (GRCh37)
Canonical SPDI:: NC_000017.11:16933162:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
HGVS:: NC_000017.11:g.16933163G>A, NC_000017.10:g.16836477G>A, NR_147084.1:n.14C>T

Select item 148230494611.

rs1482304946 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16923828 (GRCh38)
17:16827142 (GRCh37)
Canonical SPDI:: NC_000017.11:16923827:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: A=0.000198/3 (ALFA)
A=0.000004/1 (TOPMED)
A=0.000036/5 (GnomAD)
A=0.000156/1 (1000Genomes)
A=0.00067/3 (Estonian)
HGVS:: NC_000017.11:g.16923828G>A, NC_000017.10:g.16827142G>A, NR_147084.1:n.2369C>T

Select item 148220903212.

rs1482209032 [Homo sapiens]

Variant type:: SNV
Alleles:: A>G [Show Flanks]
Chromosome:: 17:16929251 (GRCh38)
17:16832565 (GRCh37)
Canonical SPDI:: NC_000017.11:16929250:A:G
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: G=0./0 (ALFA)
G=0.000008/2 (TOPMED)
HGVS:: NC_000017.11:g.16929251A>G, NC_000017.10:g.16832565A>G, NR_147084.1:n.1068T>C

Select item 148188490613.

rs1481884906 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16923298 (GRCh38)
17:16826612 (GRCh37)
Canonical SPDI:: NC_000017.11:16923297:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: A=0./0 (ALFA)
A=0.000011/3 (TOPMED)
A=0.000029/4 (GnomAD)
HGVS:: NC_000017.11:g.16923298G>A, NC_000017.10:g.16826612G>A, NR_147084.1:n.2899C>T

Select item 148079179514.

rs1480791795 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 17:16925923 (GRCh38)
17:16829237 (GRCh37)
Canonical SPDI:: NC_000017.11:16925922:C:T
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0.000071/1 (ALFA)
T=0.000023/6 (TOPMED)
T=0.000029/4 (GnomAD)
HGVS:: NC_000017.11:g.16925923C>T, NC_000017.10:g.16829237C>T, NR_147084.1:n.1588G>A

Select item 148021274615.

rs1480212746 [Homo sapiens]

Variant type:: SNV
Alleles:: G>C [Show Flanks]
Chromosome:: 17:16923491 (GRCh38)
17:16826805 (GRCh37)
Canonical SPDI:: NC_000017.11:16923490:G:C
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: C=0./0 (ALFA)
C=0.000004/1 (TOPMED)
HGVS:: NC_000017.11:g.16923491G>C, NC_000017.10:g.16826805G>C, NR_147084.1:n.2706C>G

Select item 147980565316.

rs1479805653 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16925937 (GRCh38)
17:16829251 (GRCh37)
Canonical SPDI:: NC_000017.11:16925936:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: A=0.00014/2 (ALFA)
HGVS:: NC_000017.11:g.16925937G>A, NC_000017.10:g.16829251G>A, NR_147084.1:n.1574C>T

Select item 147854489517.

rs1478544895 [Homo sapiens]

Variant type:: SNV
Alleles:: A>G [Show Flanks]
Chromosome:: 17:16923127 (GRCh38)
17:16826441 (GRCh37)
Canonical SPDI:: NC_000017.11:16923126:A:G
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: G=0./0 (ALFA)
HGVS:: NC_000017.11:g.16923127A>G, NC_000017.10:g.16826441A>G, NR_147084.1:n.3070T>C

Select item 147820199618.

rs1478201996 [Homo sapiens]

Variant type:: SNV
Alleles:: G>T [Show Flanks]
Chromosome:: 17:16927701 (GRCh38)
17:16831015 (GRCh37)
Canonical SPDI:: NC_000017.11:16927700:G:T
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: T=0./0 (ALFA)
T=0.000004/1 (TOPMED)
HGVS:: NC_000017.11:g.16927701G>T, NC_000017.10:g.16831015G>T, NR_147084.1:n.1199C>A

Select item 147713116419.

rs1477131164 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 17:16923367 (GRCh38)
17:16826681 (GRCh37)
Canonical SPDI:: NC_000017.11:16923366:G:A
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: A=0./0 (ALFA)
A=0.000015/4 (TOPMED)
HGVS:: NC_000017.11:g.16923367G>A, NC_000017.10:g.16826681G>A, NR_147084.1:n.2830C>T

Select item 147363045820.

rs1473630458 [Homo sapiens]

Variant type:: SNV
Alleles:: A>G [Show Flanks]
Chromosome:: 17:16926944 (GRCh38)
17:16830258 (GRCh37)
Canonical SPDI:: NC_000017.11:16926943:A:G
Gene:: TBC1D27P (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: G=0./0 (ALFA)
G=0.000008/2 (TOPMED)
G=0.000014/2 (GnomAD)
HGVS:: NC_000017.11:g.16926944A>G, NC_000017.10:g.16830258A>G, NR_147084.1:n.1232T>C

dbSNP

Result Filters

Validation Status

Publication

Function Class

Variation Class

Annotation

Global MAF

Custom range

Additional filters

Display Settings:

Send to:

Links from Nucleotide

Items: 1 to 20 of 813

Display Settings:

Send to:

Supplemental Content

Find related data

Recent activity