RNA-Seq of Chromobacterium violaceum: wild type; Biological replicate... - SRA

Links from BioSample

SRX21414727: RNA-Seq of Chromobacterium violaceum: wild type; Biological replicate 2
1 ILLUMINA (NextSeq 2000) run: 8.5M spots, 1.7G bases, 522.3Mb downloads

Design: Chromobacterium violaceum wild type (WT) strain ATCC 12472 was grown in LB medium (15 ml) at 37C with shaking until exponential phase (OD600nm 1). After centrifugation at 20 000 x g for 1 minute of 3 ml culture, total RNA from bacteria was extracted with 1 ml TRIzol (Ambion), followed by incubation for 10 minutes at 65C with 0.2 volumes of chloroform. RNA was purified with the Direct-zol RNA Miniprep Plus kit (Zymo Research). The analysis of RNA integrity was performed by running the samples on a denaturing agarose gel and in an Agilent 2100 Bioanalyzer (Agilent) with a Prokaryote Total RNA Nano kit. Depletion of ribosomal RNA (rRNA) and preparation of stranded-specific libraries were performed with the Illumina Stranded Total RNA, with Ribo-Zero Plus kit. The libraries were sequenced using the NextSeq 500/550 Mid Output v2 kit (150 cycles, 2x100) in an Illumina NextSeq2000 equipment, at NGS Solucoes Genomicas facility, Piracicaba, Brazil. The following sequences may be used to trim adapters. Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT.

Submitted by: Faculdade de Medicina de Ribeirao Preto da Universidade de Sao Paulo (FMRP-USP)

Study: Deciphering the Fur regulon in Chromobacterium violaceum

PRJNA1006746 • SRP455816 • All experiments • All runs

show Abstracthide Abstract

To identify the global repertoire of Fur-regulated genes in the opportunistic pathogen Chromobacterium violaceum, we performed RNa-seq analysis comparing the transcriptome of wild type and fur mutant strains. As expected, Fur acted as a global regulator repressing several genes related to iron acquisition. Importantly, Fur also repressed gene clusters of genomic islands as those encoding putative prophages, R-bodies, and the virulence-associated Cpi1/1a T3SS pathogenicity island. Our data indicated that complex networks of Fur-regulated genes allow C. violaceum to control many processes according to iron availability.

Sample:

SAMN37047943 • SRS18653188 • All experiments • All runs

Organism: Chromobacterium violaceum

Library:

Name: WT2

Instrument: NextSeq 2000

Strategy: RNA-Seq

Source: TRANSCRIPTOMIC

Selection: RT-PCR

Layout: PAIRED

Runs: 1 run, 8.5M spots, 1.7G bases, 522.3Mb

Run	# of Spots	# of Bases	Size	Published
SRR25689555	8,507,507	1.7G	522.3Mb	2024-02-16

ID:: 28853135

SRA

Sequence Read Archive

Result Filters

Send to:

Links from BioSample

Supplemental Content

Related information

Recent activity