U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

Links from BioSample

SRX24195410: Amplicon sequencing
1 ILLUMINA (Illumina MiSeq) run: 36,736 spots, 11.1M bases, 6.3Mb downloads

Design: DNA extraction, sample preparation including amplification of V1-3 region of 16S rRNA gene using the 27F (AGAGTTTGATCCTGGCTCAG) (Lane, 1991) and 534R 194 (ATTACCGCGGCTGCTGG) (Muyzer et al., 1993) primers, and amplicon sequencing were conducted as described by Dottorini et al., (2021)
Submitted by: Aalborg University
Study: Activated sludge and influent from Danish wastewater treatment plants
PRJNA1088318 • SRP500504 • All experiments • All runs
show Abstracthide Abstract
Microbial core communities in activated sludge plants are strongly affected by immigration and geography. This project encompasses Illumina 16S rRNA gene amplicon data from activated sludge and influent from >80 Danish wastewater treatment plants.
Sample:
SAMN40892640 • SRS20969182 • All experiments • All runs
Organism: wastewater metagenome
Library:
Name: LIB-Fredericia-458
Instrument: Illumina MiSeq
Strategy: AMPLICON
Source: METAGENOMIC
Selection: PCR
Layout: SINGLE
Runs: 1 run, 36,736 spots, 11.1M bases, 6.3Mb
Run# of Spots# of BasesSizePublished
SRR2859656336,73611.1M6.3Mb2024-09-03

ID:
32506935

Supplemental Content

Related information

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...