U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

Links from BioSample

SRX24195444: Amplicon sequencing
1 ILLUMINA (Illumina MiSeq) run: 35,302 spots, 10.6M bases, 6.5Mb downloads

Design: DNA extraction, sample preparation including amplification of V1-3 region of 16S rRNA gene using the 27F (AGAGTTTGATCCTGGCTCAG) (Lane, 1991) and 534R 194 (ATTACCGCGGCTGCTGG) (Muyzer et al., 1993) primers, and amplicon sequencing were conducted as described by Dottorini et al., (2021)
Submitted by: Aalborg University
Study: Activated sludge and influent from Danish wastewater treatment plants
show Abstracthide Abstract
Microbial core communities in activated sludge plants are strongly affected by immigration and geography. This project encompasses Illumina 16S rRNA gene amplicon data from activated sludge and influent from >80 Danish wastewater treatment plants.
Sample:
SAMN40892782 • SRS20969216 • All experiments • All runs
Library:
Name: LIB-Viby-LT-192
Instrument: Illumina MiSeq
Strategy: AMPLICON
Source: METAGENOMIC
Selection: PCR
Layout: SINGLE
Runs: 1 run, 35,302 spots, 10.6M bases, 6.5Mb
Run# of Spots# of BasesSizePublished
SRR2859652935,30210.6M6.5Mb2024-09-03

ID:
32506969

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...