NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7216 Query DataSets for GPL7216
Status Public on Mar 25, 2009
Title Payne Aspergillus flavus 13,548 v1.0
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Aspergillus flavus
Manufacturer Affymetrix
Manufacture protocol Standard Affymetrix protocols were followed and can be found at http://www.affymetrix.com/support/technical/manual/technical_manual.afx
 
 
Submission date Aug 27, 2008
Last update date Mar 25, 2009
Contact name Carrie A. Smith
Organization name NC State University
Department Department of Plant Pathology
Lab Payne Lab
Street address 2510 Gardner Hall
City Raleigh
State/province NC
ZIP/Postal code 27695
Country USA
 
Samples (6) GSM315718, GSM315719, GSM315720, GSM315721, GSM315722, GSM315723
Series (1)
GSE12594 The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus

Data table header descriptions
ID
PROBE ID Affy ID = term to identify each element on the array; corresponds to ID in the Aspergillus flavus genome browser
Description predicted protein functions
GO terms Go terms associated with each gene
Interpro Interpro terms associated with each gene
SEQUENCE
SPOT_ID spot identifier

Data table
ID PROBE ID Description GO terms Interpro SEQUENCE SPOT_ID
1 1569.m00001_at LOC495310 protein-related GO:0005509 GO:0048037 IPR002048, IPR006163 TTCGTGGCCCAACGCTTGCAGAATG LOC495310 protein-related
2 1569.m00002_at hypothetical protein GO:0004872 GO:0015031 GO:0016021 IPR000133 TTCTCTTCCCACATGACTATAGCGT hypothetical protein
3 1569.m00003_at cytokinesis regulator (Byr4), putative TTATCACCAATGTAGGCGCGATGCA cytokinesis regulator (Byr4), putative
4 1569.m00004_at hypothetical protein TTTCCGCGAAGACACAGCACGAAGA hypothetical protein
5 1569.m00005_at NADH-ubiquinone oxidoreductase 78 kDa subunit, mitochondrial precursor, putative TGCTGGTGAAATGTCTCCCCAAGCT NADH-ubiquinone oxidoreductase 78 kDa subunit, mitochondrial precursor, putative
6 1569.m00006_at ER to Golgi transport protein (Sly41), putative TTACAGTCTTAGCATACCGCGTGTT ER to Golgi transport protein (Sly41), putative
7 1569.m00007_at hypothetical protein TACGCTACGGTACGCACAGGAGCTT hypothetical protein
8 1569.m00008_at Peptidase family M1 containing protein GO:0004179 GO:0006508 IPR001930 TTGAGGCTCGCCTGTCGTCAAATAA Peptidase family M1 containing protein
9 1569.m00009_at hypothetical protein GTCGGCCGTCGTCTTTTGAAATGGC hypothetical protein
10 1569.m00010_at RAB GTPase Ypt1, putative TATGGGTACCGCCACTGTCAACAAC RAB GTPase Ypt1, putative
11 1569.m00011_at Mitochondrial carrier protein GO:0005488 GO:0006810 GO:0016020 IPR001993 TACAGTACACCATCTTTGAGCAGTT Mitochondrial carrier protein
12 1569.m00012_at conserved hypothetical protein TAAGGCAGCTGGACGGTATTCCTCC conserved hypothetical protein
13 1569.m00013_at WW domain containing protein TTGACGGTGGCGACTTCGGCGATTT WW domain containing protein
14 1569.m00014_at conserved hypothetical protein TTACCGGGTTGATGTCGCTGCAGAC conserved hypothetical protein
15 1569.m00015_at AMP-binding enzyme family protein GO:0003824 GO:0008152 IPR000873 GGCCGGCCCATGAGTGAGACCGATA AMP-binding enzyme family protein
16 1569.m00016_at proline permease, putative GO:0006810 GO:0006865 GO:0015359 GO:0016020 GO:0016021 IPR004841, IPR004762 TTCAAAGCGATGTGGCAGCCCTGGT proline permease, putative
17 1569.m00017_at hypothetical protein TATCGGAGCTTTGCGTACCAGGTCA hypothetical protein
18 1569.m00018_at cystathionine gamma-lyase, putative GO:0006520 GO:0009072 GO:0016765 GO:0016830 IPR000277, IPR011166, IPR006235 TTGCAATCCATCCTTGGTCTACGAC cystathionine gamma-lyase, putative
19 1569.m00019_at RNA binding protein Nrd1, putative GO:0003676 IPR000504 TCAAGATGATCAGCCGCCAGGATGC RNA binding protein Nrd1, putative
20 1569.m00020_at citrate synthase, eukaryotic, putative GO:0004108 GO:0005737 GO:0006092 GO:0006099 GO:0046912 IPR010109, IPR002020 TTACGCCAAGCTTGTCGGTGCCAAG citrate synthase, eukaryotic, putative

Total number of rows: 13548

Table truncated, full table size 1823 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap