GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM438362

Query DataSets for GSM438362

Status

Public on Oct 13, 2009

Title

Sequencing of small RNA from the H1 cell line; smRNA-seq_h1_r1

Sample type

SRA

Source name

Sequencing of small RNA from the H1 cell line

Organism

Homo sapiens

Characteristics

disease: None
biomaterial_provider: Thomson Laboratory
biomaterial_type: Cell Line
line: H1
lineage: NA
batch: 1
differentiation_stage: embryonic stem cell
differentiation_method: NA
passage: 25
medium: TeSR
Sex: Male
experiment_type: smRNA-Seq
extraction_protocol: mirVana miRNA isolation kit (Applied Biosystems), performed as per manufacturer's instructions to isolate small RNAs, followed by treatment with DNaseI (Qiagen) for 30 min at room temperature.
extraction_protocol_smrna_enrichment: The small RNA fraction were separated by electrophoresis on a 15% TBE-urea gel and RNA molecules between approximately 10 and 50 nt were excised and eluted from the gel fragments then ethanol precipitated, resuspending in 6 µl.
smrna_preparation_initial_smrna_qnty: Equivalent to the quantity of smRNAs isolated from 5 µg of total RNA.
rna_preparation_5'_rna_adapter_sequence: 5' GUUCAGAGUUCUACAGUCCGACGAUC
rna_preparation_3'_rna_adapter_sequence: 5' UCGUAUGCCGUCUUCUGCUUGidT, 5' adenylated (Illumina)
rna_preparation_reverse_transcription_primer_sequence: 5' CAAGCAGAAGACGGCATACGA
rna_preparation_3'_rna adapter_ligation_protocol: 1 µl of 1:10 diluted adenylated 3’ RNA adapter oligonucleotide was added to the 6 µl of smRNA and incubated at 70˚C for 2 min followed by placement on ice. The 3’ RNA adapter ligation reaction was performed by addition of 2 µl 5x T4 RNA ligase 2 truncated ligation buffer, 20 U RNaseOut and 300 U T4 RNA ligase 2 truncated (New England Biolabs) and incubation at 22˚C for 1 h.
rna_preparation_5'_rna_adapter_ligation_protocol: Ligation of the 5’ RNA adapter was performed by addition to the 3’ adapter ligated reaction of 0.5 µl heat denatured (70˚C 2 min) 5’ RNA adapter oligonucleotide, 1 µl 10 mM ATP, and 10 U T4 RNA ligase (Promega), and incubation at 20˚C for 6 h.
rna_preparation_reverse_transcription_protocol: To 4 µl of the RNA ligation products, 1 µl 1:5 diluted RT primer was added and heat denatured (70˚C 2 min), followed by incubation on ice. Added to the denatured RNA/primer solution was 2 µl 5x first strand buffer, 0.5 µl 12.5 mM dNTPs, 1 µl 100 mM DTT, and 20 U RNaseOut, followed by incubation at 48˚C for 3 min. To this, 100 U Superscript II reverse transcriptase (Life Technologies) was added, followed by incubation at 44˚C for 1 h.
library_generation_pcr_template: The entire reverse transcription reaction was used in the PCR enrichment of the library.
library_generation_pcr_polymerase_type: Phusion hot-start high fidelity DNA polymerase (New England Biolabs). 1x Phusion polymerase buffer and 2 U Phusion hot-start high fidelity DNA polymerase was used in a 50 µl total reaction.
library_generation_pcr_thermocycling_program: 98˚C 30 sec; 98˚C 10 sec, 60˚C 30 sec, 72˚C 15 sec; 72˚C 10 min
library_generation_pcr_number_cycles: 12
library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGA
library_generation_pcr_primer_conc: 0.25 µM
library_generation_pcr_product_isolation_protocol: PCR products were separated by electrophoresis on a 6% polyacrylamide gel and the PCR products (~90-125 bp) were excised, eluted from the crushed gel by rotation in 100 µl 1x gel elution buffer for 2 h, then ethanol precipitation of the DNA within the supernatant.

Extracted molecule

total RNA

Extraction protocol

Library construction protocol: The small RNA fraction was isolated from H1 cells then sequentially ligated to the adenylated 3' RNA adapter then to the 5' RNA adapter. Following reverse transcription of the adapter ligated small RNAs, the library was enriched by 12 cycles of PCR.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina Genome Analyzer II

Description

sample_term_id: EFO_0003042
assay_term_id: OBI_0001271
nucleic_acid_term_id: SO_0000276
Library name: smRNA-seq_h1_r1
EDACC Genboree Sample Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.1105
EDACC Genboree Experiment Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.1438

****************
For data usage terms and conditions, please refer to:
http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies
****************

Data processing

Various levels of processed data files will be made available as this project proceeds.