NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15699 Query DataSets for GPL15699
Status Public on Jun 16, 2012
Title Arabidopsis thaliana 34K NARC serie 7
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Arabidopsis thaliana
Manufacturer Norwegian Microarray Consortium, Trondheim
Manufacture protocol 1. Oligos used in the production of the microarrays are from the Qiagen-Operon Arabidopsis Genome Array Ready Oligo Set (AROS) Version 3.0, while the custom made oligos were produced by Operon (Alameda, CA, USA) or MWG (Ebersberg, Germany). Information about the AROS probes is available at: http://omad.operon.com/arabidopsis/
2. Oligos are arrayed in Genetix X6004 384 well plates with V-shaped bottom. Each well contain 600 pmol 70 mer oligo
3. Oligos were resuspended in 16 µl Milli-Q-filtered DNase free water and 8 µl from each well were transfered to new set of Genetix X6004 384 well plates using a Tecan Genesis RSP 200 liquid handling workstation.
4. 8 µl DMSO were added to each well giving a final oligo consentration of ~20 µM and 50% DMSO.
5. The plates were sealed with ABgene Adhesive PCR Foil seals and centrifuged at 1000 rpm in a Sorvall RT6000B centrifuge. The plates were stored at -20C.
6. The plates were thawed and placed on a rotary shaker for 12 hour before printing of oligos.
7. The oligos were printed on amino silane coated UltraGaps slides (Corning, NY, USA) using a BioRobotics MicroGrid II robot (Genomic Solutions, MI, USA).
8. After printing the micorarray slides were exposed for UV light in a Stratalinker 2400 UV crosslinker (Stratagene), at 800 milijoules/cm2.
9. Microarray slides were stored under low humidity conditions and not exposed to light.
Support glass
Coating amino silane
 
Description Norwegian Arabidopsis Research Center (NARC)
 
Web link http://www.mikromatrise.no/index.php?section=4
http://boneslab.bio.ntnu.no/fugenarc.html
Contributor(s) Bones AM, Winge P, Sparstad T, Bergum H
Submission date Jun 15, 2012
Last update date Jun 16, 2012
Contact name Per Winge
E-mail(s) [email protected]
Phone +47 73596229
Organization name Norwegian University of Science and Technology
Department Department of Biology
Lab Bones lab
Street address Høgskoleringen 5e
City Trondheim
ZIP/Postal code 7491
Country Norway
 
Samples (8) GSM958784, GSM958785, GSM958786, GSM958787, GSM958788, GSM958789 
Series (2)
GSE39245 Systems Biology approach to identify transcriptome reprogramming in Arabidopsis thaliana during insect and bacterial attack (Brevicoryne brassicae)
GSE39246 Systems Biology approach to identify transcriptome reprogramming in Arabidopsis thaliana during insect and bacterial attack (Pseudomonas syringae)

Data table header descriptions
ID Unique spot identifier
Block Block (1-48)
Column Column (1-26)
Row Row (1-27)
Locus ID
Oligo ID Custom oligo IDs and oligo IDs from the Qiagen-Operon Arabidopsis Genome Array Ready Oligo Set (AROS) Version 3.0 (http://omad.operon.com/arabidopsis/)
Gene_Desc Gene description (TAIR9)
SEQUENCE Probe sequence information from custom made oligos.
ORF
SPOT_ID
miRNA_ID

Data table
ID Block Column Row Locus ID Oligo ID Gene_Desc SEQUENCE ORF SPOT_ID miRNA_ID
Narc7_00001 1 1 1 At1g02305.1 A025916_01 Cysteine proteinases superfamily protein At1g02305.1
Narc7_00002 1 1 2 empty empty empty empty
Narc7_00003 1 1 3 At3g02390.1 A009458_01 unknown protein At3g02390.1
Narc7_00004 1 1 4 At2g46470.1 A008652_01 OXA1L (inner membrane protein OXA1-like) At2g46470.1
Narc7_00005 1 1 5 At3g26060.1 A020349_01 ATPRX Q (Thioredoxin superfamily protein); encodes periredoxin Q which decomposes peroxides and plays a role in the protection of the photosynthetic apparatus At3g26060.1
Narc7_00006 1 1 6 At4g09740.1 At30018720 AtGH9B14 (glycosyl hydrolase 9B14) At4g09740.1
Narc7_00007 1 1 7 At5g51500.1 A017076_01 Plant invertase/pectin methylesterase inhibitor superfamily At5g51500.1
Narc7_00008 1 1 8 At1g62855.1 A200923_01 expressed protein At1g62855.1
Narc7_00009 1 1 9 Ctrl-sp6_3/13n Probe1059 Ctrl-sp6_3/13n GCAATATTCTGCATCTTTGCACCCAGTGATTGAAATCTCTGAATATCGAACCCAGCTCTATGAATATCTA Ctrl-sp6_3/13n
Narc7_00010 1 1 10 At1g47200.1 A000960_01 WPP2 (WPP domain protein 2); WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary for NE targeting of WPP1. RNAi suppression of WPP2 resulted in reduced mitotic activity. At1g47200.1
Narc7_00011 1 1 11 At5g21020.2 A018153_01 unknown protein At5g21020.2
Narc7_00012 1 1 12 At5g10510.1 A019065_01 AIL6 (AINTEGUMENTA-like 6); Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. At5g10510.1
Narc7_00013 1 1 13 empty empty empty empty
Narc7_00014 1 1 14 At4g23100.1 A014783_01 CAD2 (CADMIUM SENSITIVE 2); Encodes the enzyme glutamate-cysteine ligase catalyzing the first, and rate-limiting, step of glutathione biosynthesis. Required for cell proliferation at the root tip. Involved in susceptibility to the bacterial pathogen Pseudomonas syringae. Mutants are phytoalexin defective. At4g23100.1
Narc7_00015 1 1 15 At1g76450.1 A003610_01 Photosystem II reaction center PsbP family protein At1g76450.1
Narc7_00016 1 1 16 At3g54480.2 At30016850 SKIP5 (SKP1/ASK-interacting protein 5); Encodes an SKP1 interacting partner (SKIP5). At3g54480.2
Narc7_00017 1 1 17 At4g04830.1 At30018394 ATMSRB5 (methionine sulfoxide reductase B5) At4g04830.1
Narc7_00018 1 1 18 At3g25717.1 A011351_01 DVL6 (DEVIL 6) At3g25717.1
Narc7_00019 1 1 19 At3g29400.1 A012469_01 ATEXO70E1 (exocyst subunit exo70 family protein E1); A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. At3g29400.1
Narc7_00020 1 1 20 At1g79750.1 A020766_01 ATNADP-ME4 (Arabidopsis thaliana NADP-malic enzyme 4); The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. At1g79750.1

Total number of rows: 33696

Table truncated, full table size 5314 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap