NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5746 Query DataSets for GPL5746
Status Public on Aug 22, 2008
Title Nimblegen 2007 Danio rerio Gene Expression Array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Danio rerio
Manufacturer Nimblegen
Manufacture protocol Organism: Danio rerio
Source: Ensembl and UCSC
Build: Zv6
Probe Length: 60mer
Probes per Array: 385,000
Feature Size: 16μm x 16μm
Array Dimensions: 17.4mm x 13mm
Overall Slide Dimensions: 1" x 3" (25 x 75mm)
Recommended Storage: Store arrays desiccated at room temperature.
Catalog Number A6183-00-01
Design Name 2007-03-01 Zv6 60mer EXP
Description Danio rerio 1-Plex Array
Genes 32,292
Probes/ Target 12
Features 385,000
Replicates 1
from www.nimblegen.com
Array Synthesis
NimbleGen manufactures custom, high-density DNA arrays based on its proprietary Maskless Array Synthesizer (MAS) technology. The MAS system is a bench top, solid-state, high-density DNA array fabrication instrument comprised of a maskless light projector, a reaction chamber, a personal computer, and a DNA synthesizer. NimbleGen builds its arrays using photo-mediated synthesis chemistry with its MAS system. At the heart of the system is a Digital Micromirror Device (DMD), similar to Texas Instruments' Digital Light Processor (DLP), employing a solid-state array of miniature aluminum mirrors to pattern 786,000 to 4.2 million individual pixels of light. The DMD creates "virtual masks" that replace the physical chromium masks used in traditional arrays. These "virtual masks" reflect the desired pattern of UV light with individually addressable aluminum mirrors controlled by the computer. The DMD controls the pattern of UV light projected on the microscope slide in the reaction chamber, which is coupled to the DNA synthesizer. The UV light selectively cleaves a UV-labile protecting group at the precise location where the next nucleotide will be coupled. The patterns are coordinated with the DNA synthesis chemistry in a parallel, combinatorial manner such that 385,000 to 2.1 million unique probe features are synthesized in a single array.
Hybridization
NimbleGen Systems has developed a proprietary hybridization system, including protocols, buffers, hybridization cassettes, hardware, and temperature control instrumentation that generate highly reproducible and sensitive hybridizations. These protocols have been optimized to require minimum amounts of sample, while providing a hybridization volume that can be continually mixed over the time-course of the incubation. This method generates arrays with extremely high inter-array reproducibility (up to r2>0.99) and very low intra-array coefficient of variation (cv < 12%) across the array surface. In a typical gene expression experiment, each gene is represented by a minimum of 10 and as many as 25 probe-pairs complementary to different portions of the mRNA transcript. This guarantees that at least 10 independent measurements of mRNA concentration are included in the final value for the expression level for the gene, resulting in more reliable and reproducible gene expression calculations. In addition, these 10 to 25 probe-pairs are distributed evenly across the surface of the array. This distribution effectively eliminates problems associated with any local variation in the spatial uniformity or noise in the hybridization, because expression values are derived from a minimum of ten different locations on the array.
Catalog number A6183-00-01
 
Description Expression design for Danio rerio from ZGI release 16. Selected 9 probes per target for 43422 targets (33752 EST entries, with some represented on both strands). Several hundred targets have less than 9 probes with many as low as one probe per target. There are 1,347 targets for which we cannot select any probes.
 
Contributor(s) McReynolds LJ, Gupta S, Figueroa ME, Mullins MC, Evans T
Submission date Aug 15, 2007
Last update date Aug 22, 2008
Contact name Lisa J. McReynolds
E-mail(s) [email protected]
Organization name Albert Einstein College of Medicine
Department Developmental and Molecular Biology
Lab Todd Evans
Street address 1300 Morris Park Ave. Chanin 501
City Bronx
State/province NY
ZIP/Postal code 10461
Country USA
 
Samples (3) GSM225561, GSM225564, GSM225567
Series (1)
GSE8903 Comparsion of Smad1 and Smad5 Dependent Transcript Profiles in Zebrafish

Data table header descriptions
ID
CONTAINER which block was used for hybridization
DESIGN_NOTE rank selected or random
SELECTION_CRITERIA for making oligos
SEQ_ID SEQ-ID from Nimblegen for Identifying Oligos
SEQUENCE Oligo sequence
MISMATCH mismatch
MATCH_INDEX match index
FEATURE_ID feature id
ROW_NUM row
COL_NUM column
PROBE_CLASS experimental
PROBE_ID Probe ID from Nimblegen
POSITION where on the chip
DESIGN_ID 5035
X coordinate
Y coordinate

Data table
ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS PROBE_ID POSITION DESIGN_ID X Y
5035_0001_0001 BLOCK1 rank_selected rank:08;score:125;uniq:24;freq:37;rules:0;tm:78.3 DRER0016S00035806 CGTTCTAATGAGAACATCTTGAAACAGGTCGATGACCTTTAGCAGGACACAGCTGTGAAG 0 64469663 64469663 1 1 experimental DRERP00309757 393 5035 1 1
5035_0023_0001 BLOCK1 rank_selected rank:01;score:011;uniq:18;freq:37;rules:0;tm:71.5 DRER0016S00043331 TGTAAATACTGTATCCCTTTCTGTTATAGAAGTCTGTATTCAATTCTGTTCATGAATAAA 0 64536665 64536665 1 23 experimental DRERP00376759 342 5035 23 1
5035_0025_0001 BLOCK1 rank_selected rank:02;score:150;uniq:28;freq:74;rules:0;tm:82.4 DRER0016S00008823 ATTGTGTTCGGGGTGGTCATTGGCATTGTGGCCGTAGGCATTGTGGCACTGCTGATGTCC 0 64234616 64234616 1 25 experimental DRERP00074710 34 5035 25 1
5035_0027_0001 BLOCK1 rank_selected rank:06;score:080;uniq:10;freq:37;rules:0;tm:76.3 DRER0016S00002877 TAAACCATGACAAGCTGACCTGTTACCTGATTGCGGTTTGTGAATACAAAACTCATATGG 0 64183473 64183473 1 27 experimental DRERP00023567 2383 5035 27 1
5035_0029_0001 BLOCK1 rank_selected rank:07;score:116;uniq:21;freq:37;rules:0;tm:77.0 DRER0016S00031749 TCAGCTGGTTCGCTCATCTGTTCGGGTTTTCATTGAGAGGTCTAATGAATTTTGTGTAGT 0 64433468 64433468 1 29 experimental DRERP00273562 335 5035 29 1
5035_0031_0001 BLOCK1 rank_selected rank:03;score:135;uniq:25;freq:37;rules:0;tm:80.4 DRER0016S00004945 TGTGTGAACTACCTGAAACTGCCGGATTACTCCAGCATCGAGATCATGCGCGAGAAACTG 0 64201041 64201041 1 31 experimental DRERP00041135 140 5035 31 1
5035_0033_0001 BLOCK1 rank_selected rank:03;score:158;uniq:20;freq:37;rules:0;tm:73.6 DRER0016S00016480 TGTCATTGTGAAGCTTTTGTGTTGTGCATTCTTGTAAAAATGGAATCACTTCCATTTACA 0 64299913 64299913 1 33 experimental DRERP00140007 1895 5035 33 1
5035_0035_0001 BLOCK1 rank_selected rank:05;score:129;uniq:15;freq:37;rules:0;tm:74.2 DRER0016S00027916 ACACTGAAAACCTAGGACATCCACTTCTGAAATGATGTATCTCTCATTTCACTTCATTTA 0 64399395 64399395 1 35 experimental DRERP00239489 2 5035 35 1
5035_0037_0001 RANDOM 17-38 RANDOM_GC17_GC38 GACACAACCCGAAGGGGCTACGGCCGCCTGGTTGGTCACATCCAGCAGTT 0 64559393 64559393 1 37 RANDOM00010180 0 5035 37 1
5035_0039_0001 BLOCK1 rank_selected rank:03;score:107;uniq:07;freq:37;rules:0;tm:68.8 DRER0016S00038902 TATAAAAATAATCCATACTCAAGTTAACAGAGCTAATATATATATAACGTTTATGATTGA 0 64497320 64497320 1 39 experimental DRERP00337414 29 5035 39 1
5035_0041_0001 BLOCK1 rank_selected rank:02;score:185;uniq:32;freq:37;rules:0;tm:78.3 DRER0016S00043200 TACTGAGGAATTCAGTCCAATTTGAGTCCGCCAACAGAGGGTACGGTTATCTGATACACA 0 64535489 64535489 1 41 experimental DRERP00375583 266 5035 41 1
5035_0043_0001 BLOCK1 rank_selected rank:02;score:200;uniq:32;freq:37;rules:0;tm:80.4 DRER0016S00018324 CAGGAGTTTGAGAGCGTCAGGCTCAATGAGACGCTCTCCTTTTTCTCCGATGACAACAAG 0 64314663 64314663 1 43 experimental DRERP00154757 11 5035 43 1
5035_0045_0001 BLOCK1 rank_selected rank:06;score:129;uniq:24;freq:37;rules:0;tm:77.0 DRER0016S00025890 ACTTGCGATAAACGGCACTTAAGTGATGGAGCGGAGTGTAGACATCATATAAAAGTCAAG 0 64381384 64381384 1 45 experimental DRERP00221478 78 5035 45 1
5035_0047_0001 BLOCK1 rank_selected rank:06;score:100;uniq:20;freq:37;rules:0;tm:74.9 DRER0016S00037648 TTATAAGCAATCCATCCACACATTGCACACTACATATTACATAAGACAGGAGCCTTATTG 0 64486064 64486064 1 47 experimental DRERP00326158 151 5035 47 1
5035_0049_0001 BLOCK1 rank_selected rank:01;score:-133;uniq:00;freq:149;rules:0;tm:79.7 DRER0016S00000261 AGTTTTCTTGGGGTGCAGAGTGCAACAGTATGCAGTCTTTGCTAAGCTGAAGCTGGTGTC 0 64162138 64162138 1 49 experimental DRERP00002232 734 5035 49 1
5035_0051_0001 BLOCK1 rank_selected rank:04;score:145;uniq:17;freq:37;rules:0;tm:81.1 DRER0016S00016961 TGGGTTCAAGGGGGGAAGCAGTTTCTTGGACAAACGTCTGCAAGTGAAGCAGTCTCAGCA 0 64303654 64303654 1 51 experimental DRERP00143748 737 5035 51 1
5035_0053_0001 BLOCK1 rank_selected rank:01;score:004;uniq:26;freq:37;rules:0;tm:82.4 DRER0016S00021139 GTGGGCTCTCGATAGAGGGCTTGGTCCCTGCTTTGGTCTCGTCTTCATTCGGAAGATGGA 0 64339047 64339047 1 53 experimental DRERP00179141 344 5035 53 1
5035_0055_0001 BLOCK1 rank_selected rank:05;score:131;uniq:16;freq:37;rules:0;tm:83.8 DRER0016S00008736 CTGATGGACCTCTCACACAGAGTGCTGCAGGTGTTGATCCGGCAGGAGGTGCAGAGGAAG 0 64233926 64233926 1 55 experimental DRERP00074020 1290 5035 55 1
5035_0165_0001 BLOCK1 rank_selected rank:05;score:147;uniq:19;freq:37;rules:0;tm:83.1 DRER0016S00014631 GCGCATCCCGGGGCTGAAGCAGGACATTGATTCTTTTCAACTCGCTCTGGAACCTGGTCC 0 64284153 64284153 1 165 experimental DRERP00124247 45 5035 165 1
5035_0167_0001 BLOCK1 rank_selected rank:02;score:153;uniq:17;freq:37;rules:0;tm:74.9 DRER0016S00016025 GTATTGCACAGATAACTTCAGGTGCTGGCTTTATCTGATGAATGAGCTTTAAAGCTTTTA 0 64296200 64296200 1 167 experimental DRERP00136294 464 5035 167 1

Total number of rows: 392778

Table truncated, full table size 89493 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap