|
| Status |
Public on Apr 10, 2013 |
| Title |
KO_siNr6a1_R1 |
| Sample type |
SRA |
| |
|
| Source name |
Dicer -/- murine MSC cell line
|
| Organism |
Mus musculus |
| Characteristics |
cell type: murine MSC cell line
genotype: Dicer -/-
strain: C57BL/6
|
| Treatment protocol |
Monoclonal immortalized Dicer WT and KO MSCs were transfected with indicated siRNAs at 20 nM using Qiagen HiPerfect transfection reagent as per manufacturer's instructions. 48 hours after transfection, cells were harvested for RNA extraction.
|
| Growth protocol |
Monoclonal immortalized Dicer WT and KO MSCs were cultured in Alpha-MEM supplemented with pen/strep and 10% fetal bovine serum.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
mRNA-sequencing was carried out with total RNA purified with the RNeasy reagent (Qiagen) and DNase-treated with TURBO Dnase. (Ambion).
RNA libraries were prepared for sequencing using standard Illumina protocols
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
mRNAs isolated from immortalized clonal lines of Dicer-/- (Dicer KO) mesenchymal stem cells (MSCs), a fibroblast cell type present in adult bone marrow, and transfected with siRNA against Nr6a1 (siNr6a1), were analyzed.
|
| Data processing |
Illumina pipeline version 1.3+ used for basecalling and sequence read generation
Sequence reads were trimmed to remove traces of adapter sequence (AGATCGGAAGAGCGGTTCAGCAGGAATG). Reads were first mapped to the mouse transcriptome (UCSC annotation, genome build mm9) and un-aligned reads were then mapped to the mouse genome where possible. Read mapping was performed with TopHat version 1.2.0 using default options. Abundance estimation and differential analysis were performed using Cufflinks version 1.0.3 with default options.
Genome_build: mm9
Supplementary_files_format_and_content: Microsoft Excel file includes FPKM (Fragments Per Kilobase of exon model per Million mapped fragments) value per gene for each sample
|
| |
|
| Submission date |
Feb 07, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
A Bhutkar |
| Organization name |
MIT
|
| Street address |
77 Massachusetts Avenue
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02139 |
| Country |
USA |
| |
|
| Platform ID |
GPL13112 |
| Series (2) |
| GSE44157 |
Let-7 represses Nr6a1 and a mid-gestation developmental program in adult fibroblasts [RNA-seq_siRNA_transfection] |
| GSE44163 |
Let-7 represses Nr6a1 and a mid-gestation developmental program in adult fibroblasts |
|
| Relations |
| Reanalyzed by |
GSE80797 |
| SRA |
SRX228557 |
| BioSample |
SAMN01915287 |
