|
| Status |
Public on Jun 28, 2013 |
| Title |
Drn1-TAP CLIP-seq replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
S. cerevisiae
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
genotype: MATa his3 1 leu2 0 met15 0 ura3 0 YGR093W::TAP-his3MX
sample type: Drn1-TAP CLIP-seq
genetic background: S288c
|
| Treatment protocol |
Cells were irradiated with 254 nm UV light at 800mJ/cm2 using a Stratalinker Model 1800 (Stratagene).
|
| Growth protocol |
Yeast cells were grown in YEPD at 30 ˚C to an OD600 ~2.0
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were frozen in liquid nitrogen and lysed with a SPEX SamplePrep 6870 Freezer Mill (SPEX CertiPrep)
The supernatant was treated with RNase A/T1 cocktail (Ambion) at 37 ˚C for 10 minutes (0.05 unit of RNase A and 2 units of RNase T1 per ml of cell lysate). The treated sample was incubated with IgG resin (GE Healthcare) to capture Drn1-TAP/Dbr1-TAP with covalently bound RNAs. The sample was treated with calf intestinal phosphatase (New England Biolabs) to remove 5’ phosphates on RNAs. A 22 nt RNA linker (5’-phosphate-AAAGAUCGGAAGAGCGGUUCAG) was ligated to the 3’ end of the RNA using T4 RNA ligase (New England Biolabs). The RNA was then radiolabeled at its 5’ end with g-32P-ATP and polynucleotide kinase. The radiolabeled Drn1/Dbr1-RNA was separated on a SDS-PAGE gel to remove co-immunoprecipitated contaminants. The sample was transferred to a nitrocellulose membrane and exposed to X-ray film to identify crosslinked proteins A small region of the membrane corresponding to the Drn1/Dbr1-RNA complex (whose migration is slightly slower than Drn1/Dbr1 alone due to the TAP tag and the RNA bound) is excised. Protein was then digested with Proteinase K (Fermentas) and another RNA linker (ACACGACGCTCTTCCGATCTAC) was ligated to the 5’ end of the RNA using T4 RNA ligase. The resulting product was amplified with RT-PCR using primers containing sequence from the RNA linker as well as sequence to be used for high throughput sequencing by the Illumina sequencer. The sequences of these primers are: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT. The final CLIP RT-PCR product was sequenced using the Illumina sequencing platforms.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Reads were aligned to theUCSC sacCer1 genome using bowtie2
BAM alignment files were processed to genome coverage in bedGraph format using bedtools
BedGraph files were coverted to BigWig format for display in the UCSC Genome Browser
Genome_build: sacCer1
Supplementary_files_format_and_content: Genome coverage for positive strand in bedGraph format
Supplementary_files_format_and_content: Genome coverage for negative strand in bedGraph format
|
| |
|
| Submission date |
Mar 07, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Jay R. Hesselberth |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Colorado School of Medicine
|
| Department |
Biochemistry and Molecular Gentetics
|
| Lab |
Jay Hesselberth
|
| Street address |
12801 E 17TH AVE
|
| City |
Aurora |
| State/province |
CO |
| ZIP/Postal code |
80045 |
| Country |
USA |
| |
|
| Platform ID |
GPL13821 |
| Series (1) |
| GSE44959 |
CLIP-seq of S. cerevisiae Drn1-TAP and Dbr1-TAP |
|
| Relations |
| SRA |
SRX248552 |
| BioSample |
SAMN01974923 |
