|
| Status |
Public on Dec 04, 2013 |
| Title |
dsDcr1, Ago1-IP |
| Sample type |
SRA |
| |
|
| Source name |
S2R+ cells with MT-DsRed-mir-144/451 vector
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell line: S2R+
ip antibody: Ago1
knockdown: dsDcr1
|
| Treatment protocol |
Cells were treated with dsRNA (75 µg total) during entire growth
|
| Growth protocol |
dsRNA (75 mg total) knockdown experiments were carried out in 10-ml MT- DsRed-mir-144/451 S2R+ cells for 8 days, with CuSO4 added on the 5th day to induce the miRNA construct.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The cells were lysed with IP/Extract buffer, and cleared by centrifugation at 14,000 rpm for 15 min at 4°C. The extracted RNA were resuspended in water and spiked in with 10 index small RNA oligos along with with 32P-labeled 19bp and 29bp oligos bearing PmeI sites.
AGO1-associated RNA was extracted using randomized 3’ adaptor (5’rAppNNNNTGGAATTCTCGGGTGCCAAGG/ 3ddC/) and randomized 5’ adaptor (5'GUUCAGAGUUCUACAGUCCGACGAUCNNNN). The ligated RNA products were reverse transcribed (RT primer 5’GCCTTGGCACCCGAGAATTCCA) at 50°C for 1 hr with SuperScript III (Life Technologies) and heat to 70°C for 15 min. The cDNAs were amplified by standard Taq polymerase (NEB) using RP1 forward primer (5’AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA) and different 5' index primers RPI (x) (NEBNext® Multiplex Oligos, Illumina) for each sample, followed by digestion of the index oligos by PmeI at 37°C for 3h.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Genome_build: n/a
trim adaptors using fastx_clipper
trim 4 random nucleotides from each end, using custom script
collapse identical reads using fastq_collapser
Supplementary_files_format_and_content: read count table files (columns are read read sequence and number of reads)
|
| |
|
| Submission date |
Oct 23, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Jakub Orzechowski Westholm |
| E-mail(s) |
[email protected]
|
| Organization name |
Memorial Sloan-Kettering Cancer Center
|
| Department |
Developmental Biology
|
| Lab |
Eric Lai
|
| Street address |
1275 York Avenue, Box 252
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE51585 |
Intertwined pathways for Argonaute-mediated microRNA biogenesis in Drosophila |
|
| Relations |
| BioSample |
SAMN02381067 |
| SRA |
SRX367011 |
